Incidental Mutation 'R7114:Olfr248'
ID551659
Institutional Source Beutler Lab
Gene Symbol Olfr248
Ensembl Gene ENSMUSG00000059503
Gene Nameolfactory receptor 248
SynonymsGA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174391046-174392055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 174391239 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 57 (M57L)
Ref Sequence ENSEMBL: ENSMUSP00000074799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075329]
Predicted Effect probably damaging
Transcript: ENSMUST00000075329
AA Change: M57L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074799
Gene: ENSMUSG00000059503
AA Change: M57L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.2e-40 PFAM
Pfam:7tm_1 39 303 7.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Olfr248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Olfr248 APN 1 174391408 missense probably damaging 1.00
R0375:Olfr248 UTSW 1 174391209 missense probably damaging 1.00
R1720:Olfr248 UTSW 1 174391920 missense probably benign 0.00
R1906:Olfr248 UTSW 1 174391164 missense probably damaging 1.00
R1996:Olfr248 UTSW 1 174391417 missense probably damaging 1.00
R2009:Olfr248 UTSW 1 174391429 missense possibly damaging 0.94
R4745:Olfr248 UTSW 1 174391876 missense probably damaging 1.00
R5294:Olfr248 UTSW 1 174391225 missense probably benign
R5297:Olfr248 UTSW 1 174391200 missense probably benign 0.21
R5665:Olfr248 UTSW 1 174391375 missense probably damaging 1.00
R5784:Olfr248 UTSW 1 174391399 missense probably damaging 1.00
R5857:Olfr248 UTSW 1 174391108 missense possibly damaging 0.59
R6943:Olfr248 UTSW 1 174391841 nonsense probably null
R6975:Olfr248 UTSW 1 174391677 missense probably benign 0.10
R7614:Olfr248 UTSW 1 174391654 missense probably damaging 0.99
R8036:Olfr248 UTSW 1 174391816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCACATTTCAGGAACCCAAAC -3'
(R):5'- AGATGGCCAGAAATCGGTC -3'

Sequencing Primer
(F):5'- TTTCAGGAACCCAAACAACAATGATC -3'
(R):5'- GGTCATACCCCATCACTGTGAG -3'
Posted On2019-05-15