Mutagenetix > Incidental Mutations

Incidental Mutation 'R7114:Nup214'

551662

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31974436-32053975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32025244 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1147 (S1147P)

Ref Sequence

ENSEMBL: ENSMUSP00000066492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065398
AA Change: S1147P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1147P

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,009,619	A1291T	probably benign	Het
Anks1b	G	A	10: 90,307,698	R523Q	probably damaging	Het
Arhgap12	T	A	18: 6,028,056	I690F	probably damaging	Het
Caln1	T	C	5: 130,839,283	V220A	possibly damaging	Het
Cd79b	T	A	11: 106,311,887	T263S	probably damaging	Het
Cep290	A	T	10: 100,543,358	K67N	probably damaging	Het
Col19a1	T	C	1: 24,337,936	T443A	possibly damaging	Het
Col25a1	A	G	3: 130,595,675	I636V	probably benign	Het
Col9a3	C	T	2: 180,603,797	P154S	unknown	Het
Cyp3a11	T	A	5: 145,858,783	M453L	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Eno1b	T	C	18: 48,047,493	V246A	possibly damaging	Het
Eogt	T	C	6: 97,116,004	Y404C	probably damaging	Het
Ephx3	T	A	17: 32,185,032	E380V	possibly damaging	Het
Fancl	T	C	11: 26,407,615	L114P	probably damaging	Het
Flad1	C	T	3: 89,407,530	G287S	probably benign	Het
Gcm1	G	T	9: 78,059,779	K93N	probably damaging	Het
Golga3	T	A	5: 110,202,712	D704E	probably benign	Het
Grb14	A	C	2: 64,916,853	I451S	probably damaging	Het
Gtf3c3	T	C	1: 54,423,507	N366D	probably benign	Het
Hecw1	A	T	13: 14,311,771	H376Q	probably benign	Het
Helb	A	T	10: 120,105,256	V509E	probably benign	Het
Hephl1	C	T	9: 15,069,815	E774K	probably damaging	Het
Hkdc1	T	C	10: 62,393,843	E685G	probably damaging	Het
Igfn1	T	C	1: 135,966,781	T2016A	probably benign	Het
Igkv5-43	T	G	6: 69,823,531	Q57H	probably damaging	Het
Lamc3	T	A	2: 31,930,645	V1224E	probably damaging	Het
Lgals3bp	C	T	11: 118,393,483	W423*	probably null	Het
Mcm9	G	A	10: 53,538,573	T137I	possibly damaging	Het
Mdga1	C	A	17: 29,842,842		probably null	Het
Mocos	C	T	18: 24,666,515	P269S	probably damaging	Het
Naa40	A	G	19: 7,229,957	V134A	probably damaging	Het
Neb	G	A	2: 52,192,559	L5680F	probably damaging	Het
Nedd9	A	G	13: 41,338,623	V137A	probably benign	Het
Nup133	T	C	8: 123,915,373	I784V	probably benign	Het
Olfr248	A	T	1: 174,391,239	M57L	probably damaging	Het
Olfr945	G	T	9: 39,258,601	Q24K	possibly damaging	Het
Plcb4	T	A	2: 135,982,123		probably null	Het
Pomt1	C	T	2: 32,253,836	T671I	probably benign	Het
Pomt2	G	T	12: 87,110,376	P723H	probably damaging	Het
Prpf8	T	A	11: 75,503,355	Y1741*	probably null	Het
Ptprs	C	G	17: 56,451,697	V175L	probably benign	Het
Slc36a4	T	C	9: 15,721,954	F95L	probably benign	Het
Smn1	C	T	13: 100,131,140	P225S	probably benign	Het
Snrpa	A	T	7: 27,191,749	I99N	probably benign	Het
Tgm5	G	T	2: 121,048,496	Y588*	probably null	Het
Tmeff2	T	A	1: 51,185,245		probably null	Het
Tmem120b	T	C	5: 123,116,678	F314S	probably damaging	Het
Trim43b	C	T	9: 89,085,608	R325H	probably benign	Het
Vmn1r26	C	T	6: 58,008,770	A145T	probably benign	Het
Wdfy4	T	C	14: 32,971,574		probably null	Het
Wnt5a	C	A	14: 28,522,756	T320K	probably damaging	Het
Wrn	AGCAGGTAATACATACCG	AG	8: 33,285,121		probably null	Het
Zfp398	T	C	6: 47,865,976	S321P	probably benign	Het
Zfp959	T	A	17: 55,898,501	C513S	possibly damaging	Het
Zfr2	A	G	10: 81,244,725	D411G	probably damaging	Het
Zkscan5	T	A	5: 145,211,178		probably benign	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	32033979	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	32006721	missense	probably benign	0.27
IGL01149:Nup214	APN	2	32034700	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	32038178	unclassified	probably benign
IGL01409:Nup214	APN	2	32026931	splice site	probably null
IGL01530:Nup214	APN	2	32033721	missense	probably benign
IGL01554:Nup214	APN	2	32051072	nonsense	probably null
IGL01944:Nup214	APN	2	32034959	nonsense	probably null
IGL02296:Nup214	APN	2	31988188	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31977860	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	32031275	missense	probably benign
IGL02858:Nup214	APN	2	32010372	splice site	probably benign
IGL02953:Nup214	APN	2	31988229	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	32018242	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31996440	missense	probably benign	0.27
IGL03225:Nup214	APN	2	32034411	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	32010221	missense	probably damaging	0.97
Des_moines	UTSW	2	31980584	splice site	probably null
ANU74:Nup214	UTSW	2	32034966	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31990367	splice site	probably null
R0243:Nup214	UTSW	2	31998057	splice site	probably benign
R0270:Nup214	UTSW	2	32034814	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	32004300	splice site	probably null
R1168:Nup214	UTSW	2	32025301	missense	probably benign
R1242:Nup214	UTSW	2	31977770	missense	probably benign	0.00
R1481:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31996380	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	32026875	missense	probably benign
R2924:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31976620	missense	probably benign	0.00
R3426:Nup214	UTSW	2	32033403	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	32034682	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	32051100	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31994684	missense	probably benign
R4353:Nup214	UTSW	2	31977917	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31997965	missense	probably benign	0.36
R4626:Nup214	UTSW	2	32033404	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31980584	splice site	probably null
R4938:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31991317	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	32017146	missense	unknown
R5406:Nup214	UTSW	2	32002607	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31988176	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	32034373	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	32010296	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31991341	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31979778	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	32051796	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	32002932	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31991372	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31982671	nonsense	probably null
R6970:Nup214	UTSW	2	32051798	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	32034156	missense	probably benign	0.22
R7120:Nup214	UTSW	2	32051042	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31988233	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	32026905	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	32033350	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31994726	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31996446	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	32039360	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31990254	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	32039360	missense	probably benign	0.05
RF015:Nup214	UTSW	2	32034706	missense	probably benign	0.00
X0026:Nup214	UTSW	2	32020306	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	32042476	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	32011223	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	32010258	missense	possibly damaging	0.66
Z1176:Nup214	UTSW	2	32034225	nonsense	probably null
Z1177:Nup214	UTSW	2	31997959	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGTTAACAAGGTCATTGGCTTG -3'
(R):5'- GTCAGGACTGGCATGAGTTATG -3'

Sequencing Primer
(F):5'- GTCCAAGACATCTGTATGC -3'
(R):5'- TGGAAAAGAAGTGTCAGCCCTTTC -3'

Posted On

2019-05-15