Incidental Mutation 'R7114:Pomt1'
ID551663
Institutional Source Beutler Lab
Gene Symbol Pomt1
Ensembl Gene ENSMUSG00000039254
Gene Nameprotein-O-mannosyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32236590-32255005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32253836 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 671 (T671I)
Ref Sequence ENSEMBL: ENSMUSP00000038722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
Predicted Effect probably benign
Transcript: ENSMUST00000002625
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036473
AA Change: T671I

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254
AA Change: T671I

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132516
Predicted Effect probably benign
Transcript: ENSMUST00000138133
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Pomt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pomt1 APN 2 32241772 missense probably benign
IGL01926:Pomt1 APN 2 32243472 missense probably benign 0.23
IGL02237:Pomt1 APN 2 32245677 missense probably benign 0.18
IGL02281:Pomt1 APN 2 32248646 missense possibly damaging 0.95
IGL03001:Pomt1 APN 2 32244326 missense probably benign
IGL03216:Pomt1 APN 2 32242943 missense probably damaging 0.99
IGL03343:Pomt1 APN 2 32253712 splice site probably benign
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0975:Pomt1 UTSW 2 32253895 critical splice donor site probably null
R1199:Pomt1 UTSW 2 32250492 missense probably benign
R1414:Pomt1 UTSW 2 32243610 splice site probably benign
R1421:Pomt1 UTSW 2 32236753 unclassified probably benign
R1806:Pomt1 UTSW 2 32241668 missense probably damaging 1.00
R2173:Pomt1 UTSW 2 32250900 missense probably damaging 1.00
R2209:Pomt1 UTSW 2 32250862 missense possibly damaging 0.90
R2302:Pomt1 UTSW 2 32243659 missense probably benign 0.00
R3084:Pomt1 UTSW 2 32244240 missense probably benign 0.02
R3774:Pomt1 UTSW 2 32244250 missense possibly damaging 0.93
R3933:Pomt1 UTSW 2 32245619 missense probably benign 0.00
R4177:Pomt1 UTSW 2 32248677 missense probably damaging 0.99
R4626:Pomt1 UTSW 2 32254412 missense possibly damaging 0.84
R4645:Pomt1 UTSW 2 32242876 intron probably benign
R4864:Pomt1 UTSW 2 32251992 missense probably benign 0.02
R4911:Pomt1 UTSW 2 32241679 missense probably damaging 0.97
R5143:Pomt1 UTSW 2 32254329 missense probably benign 0.23
R5288:Pomt1 UTSW 2 32244299 nonsense probably null
R5385:Pomt1 UTSW 2 32244299 nonsense probably null
R5718:Pomt1 UTSW 2 32248692 missense possibly damaging 0.91
R5735:Pomt1 UTSW 2 32243505 missense probably damaging 1.00
R5754:Pomt1 UTSW 2 32247590 missense probably damaging 0.99
R5817:Pomt1 UTSW 2 32248679 missense probably damaging 0.97
R6304:Pomt1 UTSW 2 32250790 missense probably damaging 1.00
R6477:Pomt1 UTSW 2 32248716 splice site probably null
R6793:Pomt1 UTSW 2 32242949 missense probably damaging 1.00
R6918:Pomt1 UTSW 2 32252861 splice site probably null
R8140:Pomt1 UTSW 2 32244297 missense probably damaging 1.00
R8380:Pomt1 UTSW 2 32245607 missense probably damaging 1.00
Z1177:Pomt1 UTSW 2 32237089 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTCATCAATCAGCCCAC -3'
(R):5'- ATCAGGGTCCTCTGCTCTAACC -3'

Sequencing Primer
(F):5'- AGTGTCATCAATCAGCCCACTTAGTC -3'
(R):5'- GGGTCCTCTGCTCTAACCAAAAG -3'
Posted On2019-05-15