Mutagenetix > Incidental Mutations

Incidental Mutation 'R7114:Tgm5'

551666

Institutional Source

Beutler Lab

Gene Symbol

Tgm5

Ensembl Gene

ENSMUSG00000053675

Gene Name

transglutaminase 5

Synonyms

2310007C07Rik, TGx

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R7114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121046111-121085841 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 121048496 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 588 (Y588*)

Ref Sequence

ENSEMBL: ENSMUSP00000028721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028721]

Predicted Effect

probably null
Transcript: ENSMUST00000028721
AA Change: Y588*

SMART Domains

Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: Y588*

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	11	127	1.4e-31	PFAM
TGc	275	368	1.86e-49	SMART
Pfam:Transglut_C	511	610	2.5e-23	PFAM
Pfam:Transglut_C	624	722	1.8e-27	PFAM

Meta Mutation Damage Score

0.9702

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	T	11: 120,009,619	A1291T	probably benign	Het
Anks1b	G	A	10: 90,307,698	R523Q	probably damaging	Het
Arhgap12	T	A	18: 6,028,056	I690F	probably damaging	Het
Caln1	T	C	5: 130,839,283	V220A	possibly damaging	Het
Cd79b	T	A	11: 106,311,887	T263S	probably damaging	Het
Cep290	A	T	10: 100,543,358	K67N	probably damaging	Het
Col19a1	T	C	1: 24,337,936	T443A	possibly damaging	Het
Col25a1	A	G	3: 130,595,675	I636V	probably benign	Het
Col9a3	C	T	2: 180,603,797	P154S	unknown	Het
Cyp3a11	T	A	5: 145,858,783	M453L	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Eno1b	T	C	18: 48,047,493	V246A	possibly damaging	Het
Eogt	T	C	6: 97,116,004	Y404C	probably damaging	Het
Ephx3	T	A	17: 32,185,032	E380V	possibly damaging	Het
Fancl	T	C	11: 26,407,615	L114P	probably damaging	Het
Flad1	C	T	3: 89,407,530	G287S	probably benign	Het
Gcm1	G	T	9: 78,059,779	K93N	probably damaging	Het
Golga3	T	A	5: 110,202,712	D704E	probably benign	Het
Grb14	A	C	2: 64,916,853	I451S	probably damaging	Het
Gtf3c3	T	C	1: 54,423,507	N366D	probably benign	Het
Hecw1	A	T	13: 14,311,771	H376Q	probably benign	Het
Helb	A	T	10: 120,105,256	V509E	probably benign	Het
Hephl1	C	T	9: 15,069,815	E774K	probably damaging	Het
Hkdc1	T	C	10: 62,393,843	E685G	probably damaging	Het
Igfn1	T	C	1: 135,966,781	T2016A	probably benign	Het
Igkv5-43	T	G	6: 69,823,531	Q57H	probably damaging	Het
Lamc3	T	A	2: 31,930,645	V1224E	probably damaging	Het
Lgals3bp	C	T	11: 118,393,483	W423*	probably null	Het
Mcm9	G	A	10: 53,538,573	T137I	possibly damaging	Het
Mdga1	C	A	17: 29,842,842		probably null	Het
Mocos	C	T	18: 24,666,515	P269S	probably damaging	Het
Naa40	A	G	19: 7,229,957	V134A	probably damaging	Het
Neb	G	A	2: 52,192,559	L5680F	probably damaging	Het
Nedd9	A	G	13: 41,338,623	V137A	probably benign	Het
Nup133	T	C	8: 123,915,373	I784V	probably benign	Het
Nup214	T	C	2: 32,025,244	S1147P	possibly damaging	Het
Olfr248	A	T	1: 174,391,239	M57L	probably damaging	Het
Olfr945	G	T	9: 39,258,601	Q24K	possibly damaging	Het
Plcb4	T	A	2: 135,982,123		probably null	Het
Pomt1	C	T	2: 32,253,836	T671I	probably benign	Het
Pomt2	G	T	12: 87,110,376	P723H	probably damaging	Het
Prpf8	T	A	11: 75,503,355	Y1741*	probably null	Het
Ptprs	C	G	17: 56,451,697	V175L	probably benign	Het
Slc36a4	T	C	9: 15,721,954	F95L	probably benign	Het
Smn1	C	T	13: 100,131,140	P225S	probably benign	Het
Snrpa	A	T	7: 27,191,749	I99N	probably benign	Het
Tmeff2	T	A	1: 51,185,245		probably null	Het
Tmem120b	T	C	5: 123,116,678	F314S	probably damaging	Het
Trim43b	C	T	9: 89,085,608	R325H	probably benign	Het
Vmn1r26	C	T	6: 58,008,770	A145T	probably benign	Het
Wdfy4	T	C	14: 32,971,574		probably null	Het
Wnt5a	C	A	14: 28,522,756	T320K	probably damaging	Het
Wrn	AGCAGGTAATACATACCG	AG	8: 33,285,121		probably null	Het
Zfp398	T	C	6: 47,865,976	S321P	probably benign	Het
Zfp959	T	A	17: 55,898,501	C513S	possibly damaging	Het
Zfr2	A	G	10: 81,244,725	D411G	probably damaging	Het
Zkscan5	T	A	5: 145,211,178		probably benign	Het

Other mutations in Tgm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Tgm5	APN	2	121071496	missense	probably benign	0.01
IGL01148:Tgm5	APN	2	121046675	splice site	probably null
IGL01284:Tgm5	APN	2	121052547	missense	possibly damaging	0.94
IGL01370:Tgm5	APN	2	121053537	missense	probably benign	0.03
IGL01545:Tgm5	APN	2	121052808	missense	probably damaging	1.00
IGL01547:Tgm5	APN	2	121049202	splice site	probably benign
IGL01998:Tgm5	APN	2	121052439	missense	probably damaging	1.00
IGL02577:Tgm5	APN	2	121077603	missense	probably benign	0.01
IGL02636:Tgm5	APN	2	121076796	missense	probably damaging	0.99
PIT4283001:Tgm5	UTSW	2	121071585	missense	possibly damaging	0.48
R0001:Tgm5	UTSW	2	121077646	missense	probably damaging	1.00
R0013:Tgm5	UTSW	2	121076882	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0105:Tgm5	UTSW	2	121077012	missense	probably damaging	1.00
R0117:Tgm5	UTSW	2	121075102	critical splice donor site	probably null
R0145:Tgm5	UTSW	2	121077581	missense	possibly damaging	0.93
R0356:Tgm5	UTSW	2	121053574	missense	probably damaging	1.00
R0410:Tgm5	UTSW	2	121077558	missense	possibly damaging	0.46
R0519:Tgm5	UTSW	2	121048895	missense	probably damaging	1.00
R1674:Tgm5	UTSW	2	121071544	missense	possibly damaging	0.60
R1773:Tgm5	UTSW	2	121077650	missense	possibly damaging	0.67
R1864:Tgm5	UTSW	2	121075218	missense	probably damaging	1.00
R2276:Tgm5	UTSW	2	121048823	splice site	probably benign
R2511:Tgm5	UTSW	2	121076948	missense	possibly damaging	0.62
R4180:Tgm5	UTSW	2	121076961	missense	probably benign	0.13
R4230:Tgm5	UTSW	2	121070735	missense	probably damaging	1.00
R4801:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R4802:Tgm5	UTSW	2	121052472	missense	probably damaging	1.00
R5840:Tgm5	UTSW	2	121085660	critical splice donor site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R6033:Tgm5	UTSW	2	121070729	splice site	probably null
R7064:Tgm5	UTSW	2	121053514	missense	probably benign	0.04
R7102:Tgm5	UTSW	2	121046498	missense	possibly damaging	0.89
R7178:Tgm5	UTSW	2	121085768	start gained	probably benign
R7748:Tgm5	UTSW	2	121052808	missense	probably damaging	1.00
R7969:Tgm5	UTSW	2	121075169	missense	probably damaging	1.00
R8428:Tgm5	UTSW	2	121048875	missense	probably benign
RF022:Tgm5	UTSW	2	121071611	missense	probably damaging	1.00
V3553:Tgm5	UTSW	2	121071502	missense	probably damaging	1.00
X0065:Tgm5	UTSW	2	121070839	missense	probably damaging	1.00
Z1177:Tgm5	UTSW	2	121052451	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGATGTCCTCTTGAGCAG -3'
(R):5'- GTCTAGGACCTCAGAATGACTGG -3'

Sequencing Primer
(F):5'- TCCCATCCAGAGCTCAGG -3'
(R):5'- CAGAATGACTGGGTAATCTATATTGC -3'

Posted On

2019-05-15