Incidental Mutation 'R7114:Col9a3'
ID551668
Institutional Source Beutler Lab
Gene Symbol Col9a3
Ensembl Gene ENSMUSG00000027570
Gene Namecollagen, type IX, alpha 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180597790-180622189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180603797 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 154 (P154S)
Ref Sequence ENSEMBL: ENSMUSP00000099348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect unknown
Transcript: ENSMUST00000103059
AA Change: P154S
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570
AA Change: P154S

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132527
AA Change: P154S
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570
AA Change: P154S

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Col9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Col9a3 APN 2 180616434 missense probably damaging 0.96
IGL01542:Col9a3 APN 2 180609316 splice site probably benign
IGL01727:Col9a3 APN 2 180616565 critical splice donor site probably null
IGL02558:Col9a3 APN 2 180606806 critical splice acceptor site probably null
IGL03112:Col9a3 APN 2 180607642 missense possibly damaging 0.60
IGL02796:Col9a3 UTSW 2 180614162 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0477:Col9a3 UTSW 2 180609470 splice site probably benign
R0890:Col9a3 UTSW 2 180610063 missense probably benign 0.23
R1934:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R4355:Col9a3 UTSW 2 180606478 missense probably benign 0.00
R4571:Col9a3 UTSW 2 180616366 splice site probably benign
R4688:Col9a3 UTSW 2 180607631 missense probably damaging 0.99
R4731:Col9a3 UTSW 2 180610681 missense probably damaging 0.99
R4742:Col9a3 UTSW 2 180603387 missense unknown
R4847:Col9a3 UTSW 2 180615525 missense probably damaging 1.00
R4985:Col9a3 UTSW 2 180603400 missense unknown
R5488:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5489:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5573:Col9a3 UTSW 2 180619732 missense probably benign 0.17
R5575:Col9a3 UTSW 2 180598846 intron probably benign
R6820:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R7710:Col9a3 UTSW 2 180609365 missense probably damaging 0.98
R8177:Col9a3 UTSW 2 180607657 missense probably damaging 0.97
R8342:Col9a3 UTSW 2 180603390 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGATACCAGCCTGGCTTC -3'
(R):5'- TGACCAGTGCAAGGTACAGC -3'

Sequencing Primer
(F):5'- TGGCTTCATCCAGGGAGG -3'
(R):5'- TACAGCGGGCCCATTTGTG -3'
Posted On2019-05-15