Incidental Mutation 'R7114:Col25a1'
ID551670
Institutional Source Beutler Lab
Gene Symbol Col25a1
Ensembl Gene ENSMUSG00000058897
Gene Namecollagen, type XXV, alpha 1
Synonyms2700062B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location130131501-130599877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130595675 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 636 (I636V)
Ref Sequence ENSEMBL: ENSMUSP00000101960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080335] [ENSMUST00000106353] [ENSMUST00000183368]
Predicted Effect probably benign
Transcript: ENSMUST00000080335
SMART Domains Protein: ENSMUSP00000079210
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 7e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
Pfam:Collagen 311 374 5.4e-11 PFAM
Pfam:Collagen 368 427 2e-9 PFAM
Pfam:Collagen 447 504 1.6e-10 PFAM
Pfam:Collagen 494 561 3.3e-8 PFAM
Pfam:Collagen 586 660 4.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106353
AA Change: I636V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101960
Gene: ENSMUSG00000058897
AA Change: I636V

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 174 1.7e-11 PFAM
Pfam:Collagen 183 244 6.2e-12 PFAM
Pfam:Collagen 233 297 7.5e-11 PFAM
Pfam:Collagen 294 345 1.8e-9 PFAM
Pfam:Collagen 343 399 1.1e-10 PFAM
Pfam:Collagen 419 475 1.9e-10 PFAM
low complexity region 490 525 N/A INTRINSIC
Pfam:Collagen 555 622 6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183368
SMART Domains Protein: ENSMUSP00000138875
Gene: ENSMUSG00000058897

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:Collagen 119 165 6.8e-9 PFAM
low complexity region 188 246 N/A INTRINSIC
internal_repeat_2 249 294 2.8e-5 PROSPERO
internal_repeat_1 294 308 4.06e-8 PROSPERO
Pfam:Collagen 309 372 2.1e-11 PFAM
Pfam:Collagen 371 427 3.7e-10 PFAM
Pfam:Collagen 447 496 7.7e-10 PFAM
low complexity region 497 506 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
low complexity region 556 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a brain-specific membrane associated collagen. A product of proteolytic processing of the encoded protein, CLAC (collagenous Alzheimer amyloid plaque component), binds to amyloid beta-peptides found in Alzheimer amyloid plaques but CLAC inhibits rather than facilitates amyloid fibril elongation (PMID: 16300410). A study of over-expression of this collagen in mice, however, found changes in pathology and behavior suggesting that the encoded protein may promote amyloid plaque formation (PMID: 19548013). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cyanosis and abnormal body curvature with apoptosis of phrenic nerve motor neurons and failure of diaphragm innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Col25a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col25a1 APN 3 130181784 splice site probably benign
IGL00570:Col25a1 APN 3 130546432 splice site probably benign
IGL01651:Col25a1 APN 3 130566485 missense probably benign 0.06
IGL02033:Col25a1 APN 3 130388948 splice site probably benign
IGL02117:Col25a1 APN 3 130519773 splice site probably benign
IGL02290:Col25a1 APN 3 130519811 splice site probably benign
IGL03135:Col25a1 APN 3 130529683 splice site probably benign
R0526:Col25a1 UTSW 3 130476394 missense probably damaging 1.00
R0602:Col25a1 UTSW 3 130575414 splice site probably null
R0670:Col25a1 UTSW 3 130386895 missense possibly damaging 0.95
R0830:Col25a1 UTSW 3 130584726 missense probably damaging 1.00
R1220:Col25a1 UTSW 3 130388925 splice site probably benign
R1623:Col25a1 UTSW 3 130550050 missense probably damaging 1.00
R1818:Col25a1 UTSW 3 130585737 critical splice donor site probably null
R2142:Col25a1 UTSW 3 130570316 missense probably damaging 1.00
R2190:Col25a1 UTSW 3 130584715 missense probably damaging 1.00
R2901:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R2902:Col25a1 UTSW 3 130546391 missense probably damaging 1.00
R3703:Col25a1 UTSW 3 130550033 splice site probably null
R3818:Col25a1 UTSW 3 130550071 missense possibly damaging 0.88
R4726:Col25a1 UTSW 3 130519781 missense possibly damaging 0.92
R4775:Col25a1 UTSW 3 130182819 missense possibly damaging 0.96
R5036:Col25a1 UTSW 3 130583329 splice site probably null
R5110:Col25a1 UTSW 3 130584725 makesense probably null
R5501:Col25a1 UTSW 3 130595663 missense probably benign 0.07
R5686:Col25a1 UTSW 3 130564154 missense probably damaging 1.00
R5698:Col25a1 UTSW 3 130478983 critical splice acceptor site probably null
R6131:Col25a1 UTSW 3 130535465 missense probably damaging 1.00
R6142:Col25a1 UTSW 3 130583329 splice site probably benign
R6549:Col25a1 UTSW 3 130182795 missense probably benign
R6624:Col25a1 UTSW 3 130566451 splice site probably null
R6898:Col25a1 UTSW 3 130584728 critical splice donor site probably null
R7030:Col25a1 UTSW 3 130479022 critical splice donor site probably null
R7172:Col25a1 UTSW 3 130570332 nonsense probably null
R7179:Col25a1 UTSW 3 130530119 missense probably damaging 0.99
R7340:Col25a1 UTSW 3 130546357 splice site probably null
R7488:Col25a1 UTSW 3 130584701 missense probably damaging 1.00
R7699:Col25a1 UTSW 3 130522479 critical splice donor site probably null
R7976:Col25a1 UTSW 3 130496426 missense probably damaging 1.00
R8129:Col25a1 UTSW 3 130496401 missense probably damaging 1.00
R8199:Col25a1 UTSW 3 130551979 missense probably damaging 1.00
X0028:Col25a1 UTSW 3 130577318 missense possibly damaging 0.85
Z1176:Col25a1 UTSW 3 130182795 frame shift probably null
Z1177:Col25a1 UTSW 3 130522461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCTATGAATACGCGGCAC -3'
(R):5'- ATCTTCACCACCAAGCGTCG -3'

Sequencing Primer
(F):5'- TATGAATACGCGGCACACATTTC -3'
(R):5'- GCGTCGCCCAAGGAAAACTAG -3'
Posted On2019-05-15