Incidental Mutation 'R7114:Golga3'
ID 551671
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7114 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110202712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 704 (D704E)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: D744E

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: D744E

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: D704E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: D704E

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
cles UTSW 5 110188707 nonsense probably null
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
R8558:Golga3 UTSW 5 110208555 missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110202855 missense probably benign 0.05
R8887:Golga3 UTSW 5 110205760 intron probably benign
R9039:Golga3 UTSW 5 110204933 missense probably benign 0.00
R9045:Golga3 UTSW 5 110193097 missense probably benign 0.00
R9057:Golga3 UTSW 5 110184599 missense probably damaging 1.00
R9100:Golga3 UTSW 5 110189678 missense probably benign 0.31
R9112:Golga3 UTSW 5 110185891 missense probably benign 0.08
R9198:Golga3 UTSW 5 110207753 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTTGTACCAGGGTGAAAGGC -3'
(R):5'- TGACAGCCAAATCTTGTCTCAATTG -3'

Sequencing Primer
(F):5'- AGGGTGAAAGGCAGCATG -3'
(R):5'- AAAAGTCCTGATGTCTCCTCAG -3'
Posted On 2019-05-15