Incidental Mutation 'R7114:Caln1'
ID551673
Institutional Source Beutler Lab
Gene Symbol Caln1
Ensembl Gene ENSMUSG00000060371
Gene Namecalneuron 1
Synonyms9630012C17Rik, Cabp8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location130369455-130847412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130839283 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Ref Sequence ENSEMBL: ENSMUSP00000083193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086029] [ENSMUST00000111287] [ENSMUST00000111288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086029
AA Change: V220A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083193
Gene: ENSMUSG00000060371
AA Change: V220A

DomainStartEndE-ValueType
EFh 82 110 2.98e-9 SMART
EFh 118 146 2.06e-3 SMART
low complexity region 195 204 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111287
AA Change: V178A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106918
Gene: ENSMUSG00000060371
AA Change: V178A

DomainStartEndE-ValueType
EFh 40 68 2.98e-9 SMART
EFh 76 104 2.06e-3 SMART
low complexity region 153 162 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111288
AA Change: V178A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106919
Gene: ENSMUSG00000060371
AA Change: V178A

DomainStartEndE-ValueType
EFh 40 68 2.98e-9 SMART
EFh 76 104 2.06e-3 SMART
low complexity region 153 162 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with high similarity to the calcium-binding proteins of the calmodulin family. The encoded protein contains two EF-hand domains and potential calcium-binding sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Caln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Caln1 APN 5 130669551 missense probably damaging 1.00
IGL03152:Caln1 APN 5 130617852 missense probably damaging 0.97
IGL03409:Caln1 APN 5 130617878 missense probably damaging 1.00
ANU22:Caln1 UTSW 5 130669551 missense probably damaging 1.00
R0346:Caln1 UTSW 5 130822921 missense possibly damaging 0.83
R2180:Caln1 UTSW 5 130839408 makesense probably null
R2352:Caln1 UTSW 5 130506152 nonsense probably null
R5489:Caln1 UTSW 5 130414832 missense possibly damaging 0.66
R7159:Caln1 UTSW 5 130822997 missense probably benign 0.20
R7355:Caln1 UTSW 5 130414891 missense probably benign
R7611:Caln1 UTSW 5 130506077 missense probably damaging 0.99
Z1177:Caln1 UTSW 5 130839314 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGACTGTGGTTCTGATAGGGATG -3'
(R):5'- AATGAACAGAGTCTGCCCGC -3'

Sequencing Primer
(F):5'- TGGTTTACCATTTCATACGTTTCAC -3'
(R):5'- CATGCACATGCGCAGTGAG -3'
Posted On2019-05-15