Incidental Mutation 'R7114:Vmn1r26'
ID551676
Institutional Source Beutler Lab
Gene Symbol Vmn1r26
Ensembl Gene ENSMUSG00000048697
Gene Namevomeronasal 1 receptor 26
SynonymsV1rc17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location58004934-58015159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58008770 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 145 (A145T)
Ref Sequence ENSEMBL: ENSMUSP00000052301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049694] [ENSMUST00000228040] [ENSMUST00000228070] [ENSMUST00000228951]
Predicted Effect probably benign
Transcript: ENSMUST00000049694
AA Change: A145T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052301
Gene: ENSMUSG00000048697
AA Change: A145T

DomainStartEndE-ValueType
Pfam:V1R 28 293 5.8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228040
AA Change: A145T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000228070
AA Change: A145T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000228951
AA Change: A145T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Vmn1r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Vmn1r26 APN 6 58009142 missense possibly damaging 0.81
IGL02609:Vmn1r26 APN 6 58008875 missense probably damaging 1.00
R1121:Vmn1r26 UTSW 6 58008662 missense probably benign 0.43
R1881:Vmn1r26 UTSW 6 58008665 missense probably benign 0.20
R1958:Vmn1r26 UTSW 6 58008301 missense probably benign 0.01
R1978:Vmn1r26 UTSW 6 58009126 missense possibly damaging 0.83
R2106:Vmn1r26 UTSW 6 58008725 missense possibly damaging 0.69
R2117:Vmn1r26 UTSW 6 58008350 missense possibly damaging 0.65
R2323:Vmn1r26 UTSW 6 58008857 missense probably damaging 1.00
R4917:Vmn1r26 UTSW 6 58008823 missense probably damaging 0.99
R5695:Vmn1r26 UTSW 6 58008753 missense probably damaging 1.00
R6355:Vmn1r26 UTSW 6 58008551 missense probably benign 0.02
R6948:Vmn1r26 UTSW 6 58008733 missense probably damaging 0.98
R7977:Vmn1r26 UTSW 6 58008279 nonsense probably null
R7987:Vmn1r26 UTSW 6 58008279 nonsense probably null
R8311:Vmn1r26 UTSW 6 58008533 missense probably benign 0.39
RF020:Vmn1r26 UTSW 6 58008720 missense probably benign 0.35
Z1176:Vmn1r26 UTSW 6 58008597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCCAGTAATTGATGCTATG -3'
(R):5'- GAGGCCTCTCTATCTGCATCAC -3'

Sequencing Primer
(F):5'- ATGCTATGAAGATGCTTGCATTGC -3'
(R):5'- ACCTGCCTCCTGAGTGTG -3'
Posted On2019-05-15