Incidental Mutation 'R7114:Slc36a4'
ID551683
Institutional Source Beutler Lab
Gene Symbol Slc36a4
Ensembl Gene ENSMUSG00000043885
Gene Namesolute carrier family 36 (proton/amino acid symporter), member 4
Synonyms6330573I15Rik, PAT4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location15709738-15743361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15721954 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 95 (F95L)
Ref Sequence ENSEMBL: ENSMUSP00000057355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061568] [ENSMUST00000115588]
Predicted Effect probably benign
Transcript: ENSMUST00000061568
AA Change: F95L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057355
Gene: ENSMUSG00000043885
AA Change: F95L

DomainStartEndE-ValueType
Pfam:Aa_trans 54 470 4.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115588
AA Change: F95L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111251
Gene: ENSMUSG00000043885
AA Change: F95L

DomainStartEndE-ValueType
Pfam:Aa_trans 54 401 2e-66 PFAM
Pfam:AA_permease_2 56 371 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214954
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC36A4 belongs to the SLC36 family of amino acid transporters based on sequence similarity with other family members (e.g., SLC36A1; MIM 606561). SLC36 proteins contain about 500 amino acids and have 9 to 11 transmembrane domains. Unlike other SLC36 family members, which are proton-coupled amino acid transporters, SLC36A4 is a high-affinity/low-capacity non-proton-coupled amino acid transporter (Pillai and Meredith, 2011 [PubMed 21097500]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Slc36a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc36a4 APN 9 15726941 missense probably damaging 1.00
IGL03235:Slc36a4 APN 9 15723549 missense probably damaging 1.00
R0418:Slc36a4 UTSW 9 15734266 missense probably damaging 1.00
R1112:Slc36a4 UTSW 9 15723515 missense possibly damaging 0.58
R1219:Slc36a4 UTSW 9 15723536 missense probably damaging 1.00
R1858:Slc36a4 UTSW 9 15720710 missense probably damaging 1.00
R1934:Slc36a4 UTSW 9 15720789 missense probably damaging 0.99
R1975:Slc36a4 UTSW 9 15734210 missense probably damaging 1.00
R1976:Slc36a4 UTSW 9 15734210 missense probably damaging 1.00
R1977:Slc36a4 UTSW 9 15734210 missense probably damaging 1.00
R2069:Slc36a4 UTSW 9 15726980 missense probably damaging 0.97
R3735:Slc36a4 UTSW 9 15738273 nonsense probably null
R4682:Slc36a4 UTSW 9 15726848 nonsense probably null
R5244:Slc36a4 UTSW 9 15734278 missense probably benign 0.29
R5268:Slc36a4 UTSW 9 15726916 missense possibly damaging 0.74
R5641:Slc36a4 UTSW 9 15728802 splice site probably null
R5888:Slc36a4 UTSW 9 15727028 missense probably damaging 1.00
R6194:Slc36a4 UTSW 9 15726876 nonsense probably null
R6651:Slc36a4 UTSW 9 15723578 missense probably benign 0.00
R7023:Slc36a4 UTSW 9 15719633 missense probably benign 0.01
R7263:Slc36a4 UTSW 9 15722156 intron probably null
R7538:Slc36a4 UTSW 9 15734215 missense possibly damaging 0.93
R7564:Slc36a4 UTSW 9 15726812 missense probably damaging 0.99
R7757:Slc36a4 UTSW 9 15719660 missense possibly damaging 0.74
X0018:Slc36a4 UTSW 9 15734212 missense possibly damaging 0.86
Z1177:Slc36a4 UTSW 9 15719641 missense probably damaging 1.00
Z1177:Slc36a4 UTSW 9 15720720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGTCAGCAAGGTAGC -3'
(R):5'- AGTCCCATGGTCATTATCTCAGC -3'

Sequencing Primer
(F):5'- GTCAGCAAGGTAGCATCATTGTC -3'
(R):5'- ATGGTCATTATCTCAGCTGTGTC -3'
Posted On2019-05-15