Incidental Mutation 'R0598:Rnf145'
ID55169
Institutional Source Beutler Lab
Gene Symbol Rnf145
Ensembl Gene ENSMUSG00000019189
Gene Namering finger protein 145
Synonyms3732413I11Rik
MMRRC Submission 038787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0598 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location44518964-44565520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44548943 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 189 (S189P)
Ref Sequence ENSEMBL: ENSMUSP00000019333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019333] [ENSMUST00000101327]
Predicted Effect probably damaging
Transcript: ENSMUST00000019333
AA Change: S189P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019333
Gene: ENSMUSG00000019189
AA Change: S189P

DomainStartEndE-ValueType
Pfam:TRC8_N 8 506 2.8e-156 PFAM
RING 537 574 2.12e-8 SMART
low complexity region 590 601 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101327
AA Change: S189P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098881
Gene: ENSMUSG00000019189
AA Change: S189P

DomainStartEndE-ValueType
Pfam:TRC8_N 7 266 1.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124959
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,404 S196L probably benign Het
3110035E14Rik T G 1: 9,619,842 I98S probably benign Het
4933427I04Rik A T 4: 123,860,888 E198D possibly damaging Het
Abca6 A T 11: 110,197,154 I1049N probably damaging Het
Acly A T 11: 100,478,390 N1014K probably damaging Het
Aph1c A T 9: 66,833,319 W42R probably damaging Het
Bptf G T 11: 107,072,965 T1738K probably damaging Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Cpt2 G T 4: 107,906,938 T543N probably damaging Het
Dnah9 T C 11: 66,118,877 E728G probably benign Het
Doxl2 A G 6: 48,975,537 E132G probably benign Het
Gm5689 T A 18: 42,173,371 M1K probably null Het
Itgbl1 A G 14: 123,857,436 H167R possibly damaging Het
Kctd1 A G 18: 15,007,765 V40A probably damaging Het
L3mbtl4 T G 17: 68,459,773 D158E probably benign Het
Lrp8 A C 4: 107,857,237 I603L possibly damaging Het
Mrps9 C T 1: 42,905,417 T365I probably damaging Het
Olfr1389 A G 11: 49,431,403 D309G probably benign Het
Olfr20 G T 11: 73,353,903 R50L probably benign Het
Olfr403 A T 11: 74,195,832 T110S possibly damaging Het
Padi1 C A 4: 140,814,787 R608L possibly damaging Het
Pkhd1 A T 1: 20,200,890 F3146L probably damaging Het
Sez6 G T 11: 77,977,821 D974Y possibly damaging Het
St3gal3 A T 4: 118,107,632 L11Q probably benign Het
Syt14 T C 1: 192,897,314 E554G probably damaging Het
Tectb G T 19: 55,189,586 E170* probably null Het
Themis2 A T 4: 132,789,683 C169S possibly damaging Het
Tmem88b A T 4: 155,784,367 D141E probably benign Het
Uaca T A 9: 60,870,921 Y685* probably null Het
Vsnl1 T C 12: 11,386,859 S40G probably benign Het
Wdr64 A T 1: 175,805,899 Q905H probably damaging Het
Other mutations in Rnf145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rnf145 APN 11 44555212 missense possibly damaging 0.90
IGL02972:Rnf145 APN 11 44564038 missense probably benign 0.26
IGL03168:Rnf145 APN 11 44555158 missense probably damaging 1.00
IGL03185:Rnf145 APN 11 44531330 missense probably damaging 1.00
IGL02980:Rnf145 UTSW 11 44561657 missense probably benign
R0112:Rnf145 UTSW 11 44564151 missense probably benign
R0346:Rnf145 UTSW 11 44555164 missense probably damaging 1.00
R0415:Rnf145 UTSW 11 44525138 missense probably damaging 0.99
R0452:Rnf145 UTSW 11 44561760 missense probably damaging 1.00
R0487:Rnf145 UTSW 11 44555229 missense probably benign 0.21
R0631:Rnf145 UTSW 11 44560024 missense probably damaging 0.99
R0837:Rnf145 UTSW 11 44524988 missense probably benign 0.00
R1611:Rnf145 UTSW 11 44551798 missense probably damaging 1.00
R1971:Rnf145 UTSW 11 44548815 missense probably damaging 1.00
R1991:Rnf145 UTSW 11 44561466 missense possibly damaging 0.90
R2157:Rnf145 UTSW 11 44555170 missense probably damaging 1.00
R2340:Rnf145 UTSW 11 44531378 missense probably benign 0.04
R3855:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R4483:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R4564:Rnf145 UTSW 11 44548808 missense probably benign 0.25
R4922:Rnf145 UTSW 11 44557236 unclassified probably benign
R5633:Rnf145 UTSW 11 44560088 missense probably damaging 1.00
R5672:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5673:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5701:Rnf145 UTSW 11 44531293 missense possibly damaging 0.46
R5915:Rnf145 UTSW 11 44542722 critical splice donor site probably null
R6128:Rnf145 UTSW 11 44555191 missense probably damaging 1.00
R6502:Rnf145 UTSW 11 44525105 missense probably damaging 0.98
R6717:Rnf145 UTSW 11 44561490 missense probably benign 0.00
R6963:Rnf145 UTSW 11 44564277 missense probably benign 0.10
R7035:Rnf145 UTSW 11 44561756 missense probably damaging 1.00
R7154:Rnf145 UTSW 11 44524995 missense probably damaging 1.00
R7351:Rnf145 UTSW 11 44548796 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTTGTGCTCCTGCGTTATGAAGAC -3'
(R):5'- CCTGCCTGACCCAAAGCTTATCTG -3'

Sequencing Primer
(F):5'- CCTGCGTTATGAAGACGAAGC -3'
(R):5'- TCTCATAGTTACCCTGAGCAGGAG -3'
Posted On2013-07-11