Incidental Mutation 'R7114:Nedd9'
ID551700
Institutional Source Beutler Lab
Gene Symbol Nedd9
Ensembl Gene ENSMUSG00000021365
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 9
SynonymsE230025G09Rik, HEF1, Cas-L, CasL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location41309581-41487362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41338623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000021794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021794] [ENSMUST00000163623] [ENSMUST00000224803]
Predicted Effect probably benign
Transcript: ENSMUST00000021794
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021794
Gene: ENSMUSG00000021365
AA Change: V137A

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.33e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 561 3.2e-66 PFAM
Pfam:DUF3513 611 828 1.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163623
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125773
Gene: ENSMUSG00000021365
AA Change: V137A

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.42e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 559 2.7e-60 PFAM
Pfam:DUF3513 618 827 1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224803
AA Change: V131A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for one null allele exhibit impaired lymphocyte trafficking and a deficit of splenic marginal zone B cells. Mice homozygous for another null allele display impaired spatial learning and decreased hippocampal dendritic spine densities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Nedd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Nedd9 APN 13 41316234 missense probably benign 0.00
IGL01412:Nedd9 APN 13 41315786 nonsense probably null
IGL01669:Nedd9 APN 13 41338635 missense probably damaging 0.99
IGL02543:Nedd9 APN 13 41316735 missense probably damaging 1.00
IGL03302:Nedd9 APN 13 41338854 missense probably damaging 0.99
hebei UTSW 13 41338979 nonsense probably null
sheep UTSW 13 41317962 missense probably benign 0.33
yanzhao UTSW 13 41311794 missense probably damaging 1.00
R1157:Nedd9 UTSW 13 41314503 splice site probably null
R1611:Nedd9 UTSW 13 41316930 missense probably benign
R1669:Nedd9 UTSW 13 41311794 missense probably damaging 1.00
R1718:Nedd9 UTSW 13 41338926 missense probably damaging 1.00
R1775:Nedd9 UTSW 13 41317962 missense probably benign 0.33
R1971:Nedd9 UTSW 13 41338948 missense probably damaging 1.00
R2107:Nedd9 UTSW 13 41338979 nonsense probably null
R2341:Nedd9 UTSW 13 41316511 missense probably damaging 1.00
R4362:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4363:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4707:Nedd9 UTSW 13 41338575 critical splice donor site probably null
R4724:Nedd9 UTSW 13 41316597 missense possibly damaging 0.50
R4795:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4796:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4853:Nedd9 UTSW 13 41316361 missense probably benign 0.01
R4934:Nedd9 UTSW 13 41338935 missense probably damaging 1.00
R5020:Nedd9 UTSW 13 41315794 missense probably damaging 1.00
R5070:Nedd9 UTSW 13 41316598 missense probably benign 0.00
R5585:Nedd9 UTSW 13 41316474 missense probably damaging 1.00
R5588:Nedd9 UTSW 13 41315961 missense possibly damaging 0.76
R6310:Nedd9 UTSW 13 41318452 missense probably benign 0.00
R6634:Nedd9 UTSW 13 41312108 missense probably damaging 1.00
R6729:Nedd9 UTSW 13 41315802 missense probably damaging 0.99
R7172:Nedd9 UTSW 13 41316804 missense probably benign 0.01
R7477:Nedd9 UTSW 13 41318480 missense probably benign 0.02
R7665:Nedd9 UTSW 13 41316309 missense probably benign 0.01
R7672:Nedd9 UTSW 13 41338722 missense possibly damaging 0.69
R7810:Nedd9 UTSW 13 41312007 missense possibly damaging 0.52
R7893:Nedd9 UTSW 13 41315789 missense probably damaging 1.00
R7952:Nedd9 UTSW 13 41316955 missense probably damaging 1.00
R8215:Nedd9 UTSW 13 41338843 missense probably benign 0.14
R8399:Nedd9 UTSW 13 41318474 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATGTCTGGGGTAAGCCATTTAG -3'
(R):5'- GATTGGTCCAGTGCAAGAGAC -3'

Sequencing Primer
(F):5'- GGGTAAGCCATTTAGTATGTTTGC -3'
(R):5'- GTCATGAGCAGCCTACTCCTG -3'
Posted On2019-05-15