Incidental Mutation 'R7114:Smn1'
ID551701
Institutional Source Beutler Lab
Gene Symbol Smn1
Ensembl Gene ENSMUSG00000021645
Gene Namesurvival motor neuron 1
SynonymsSMN
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100124852-100137690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100131140 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 225 (P225S)
Ref Sequence ENSEMBL: ENSMUSP00000022147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022147] [ENSMUST00000091321] [ENSMUST00000140745] [ENSMUST00000143937]
Predicted Effect probably benign
Transcript: ENSMUST00000022147
AA Change: P225S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022147
Gene: ENSMUSG00000021645
AA Change: P225S

DomainStartEndE-ValueType
PDB:3S6N|M 23 59 3e-18 PDB
low complexity region 70 82 N/A INTRINSIC
TUDOR 87 146 7.06e-17 SMART
low complexity region 188 246 N/A INTRINSIC
PDB:4GLI|A 247 287 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000091321
Predicted Effect probably benign
Transcript: ENSMUST00000140745
Predicted Effect unknown
Transcript: ENSMUST00000143937
AA Change: P151S
SMART Domains Protein: ENSMUSP00000119381
Gene: ENSMUSG00000021645
AA Change: P151S

DomainStartEndE-ValueType
TUDOR 13 72 6.15e-17 SMART
low complexity region 114 158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit cell loss and peri-implantation lethality. Muscle-specific KO mice show muscle necrosis leading to paralysis and death. Neuron-specific KO mice show muscle degeneration associated with loss of motor axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Smn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Smn1 APN 13 100135684 unclassified probably benign
IGL02932:Smn1 APN 13 100127964 missense probably benign 0.40
IGL03325:Smn1 APN 13 100127857 missense probably damaging 1.00
R0907:Smn1 UTSW 13 100127896 missense probably damaging 0.99
R1573:Smn1 UTSW 13 100126610 missense probably damaging 1.00
R1629:Smn1 UTSW 13 100127896 missense probably damaging 1.00
R4898:Smn1 UTSW 13 100132423 missense probably damaging 1.00
R5082:Smn1 UTSW 13 100137382 splice site probably benign
R5902:Smn1 UTSW 13 100126904 missense probably benign 0.00
R6276:Smn1 UTSW 13 100127995 missense possibly damaging 0.66
R6481:Smn1 UTSW 13 100128500 splice site probably null
R6758:Smn1 UTSW 13 100132438 missense possibly damaging 0.88
R7378:Smn1 UTSW 13 100127865 missense probably damaging 0.99
Z1177:Smn1 UTSW 13 100126617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCGTTAACTGCTGAGCC -3'
(R):5'- TGAGACTGGGAGAGACCATC -3'

Sequencing Primer
(F):5'- AACTGCTGAGCCATCTCTCCAG -3'
(R):5'- GTAACAGAGGGCCTTCCAGAC -3'
Posted On2019-05-15