Incidental Mutation 'R7114:Zfp959'
ID551704
Institutional Source Beutler Lab
Gene Symbol Zfp959
Ensembl Gene ENSMUSG00000003198
Gene Namezinc finger protein 959
SynonymsBC011426
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7114 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55892093-55898928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55898501 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 513 (C513S)
Ref Sequence ENSEMBL: ENSMUSP00000053979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054780] [ENSMUST00000224379]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054780
AA Change: C513S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053979
Gene: ENSMUSG00000003198
AA Change: C513S

DomainStartEndE-ValueType
KRAB 4 66 5.28e-14 SMART
ZnF_C2H2 155 177 2.57e2 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 4.17e-3 SMART
ZnF_C2H2 343 365 1.47e-3 SMART
ZnF_C2H2 371 393 5.14e-3 SMART
ZnF_C2H2 399 421 1.82e-3 SMART
ZnF_C2H2 427 449 1.98e-4 SMART
ZnF_C2H2 455 477 2.57e-3 SMART
ZnF_C2H2 483 505 7.26e-3 SMART
ZnF_C2H2 511 533 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224379
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Zfp959
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfp959 APN 17 55897565 missense possibly damaging 0.91
IGL02731:Zfp959 APN 17 55895956 splice site probably benign
IGL03206:Zfp959 APN 17 55897613 missense possibly damaging 0.78
R0141:Zfp959 UTSW 17 55898139 missense probably benign 0.41
R0347:Zfp959 UTSW 17 55897180 nonsense probably null
R0522:Zfp959 UTSW 17 55896201 missense probably null 1.00
R1692:Zfp959 UTSW 17 55898299 missense probably damaging 0.99
R1771:Zfp959 UTSW 17 55897677 unclassified probably null
R1891:Zfp959 UTSW 17 55897604 missense probably damaging 1.00
R1945:Zfp959 UTSW 17 55897231 nonsense probably null
R1959:Zfp959 UTSW 17 55897404 missense probably damaging 0.98
R2317:Zfp959 UTSW 17 55897326 missense possibly damaging 0.59
R4726:Zfp959 UTSW 17 55898260 unclassified probably null
R4869:Zfp959 UTSW 17 55897228 missense possibly damaging 0.95
R5436:Zfp959 UTSW 17 55897626 missense probably benign
R6235:Zfp959 UTSW 17 55897427 missense probably damaging 1.00
R6365:Zfp959 UTSW 17 55897785 missense probably damaging 1.00
R6391:Zfp959 UTSW 17 55895854 missense probably damaging 1.00
R6417:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R6420:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R7380:Zfp959 UTSW 17 55898551 missense possibly damaging 0.94
R7437:Zfp959 UTSW 17 55898334 missense probably damaging 1.00
R7568:Zfp959 UTSW 17 55897886 missense probably benign 0.01
R8114:Zfp959 UTSW 17 55898496 missense probably benign 0.09
R8197:Zfp959 UTSW 17 55897677 missense probably damaging 1.00
R8389:Zfp959 UTSW 17 55897299 missense probably benign
Z1088:Zfp959 UTSW 17 55898135 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCCTATAAATGTAATCACTGTGGT -3'
(R):5'- AGGCTGGCCTTGAACTCAGA -3'

Sequencing Primer
(F):5'- AGGCCTTTGCATGTAACAGC -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCC -3'
Posted On2019-05-15