Incidental Mutation 'R7115:Dnajb2'
ID551711
Institutional Source Beutler Lab
Gene Symbol Dnajb2
Ensembl Gene ENSMUSG00000026203
Gene NameDnaJ heat shock protein family (Hsp40) member B2
SynonymsmDj8, 2700059H22Rik, Dnajb10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75236406-75245692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75243662 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 275 (G275D)
Ref Sequence ENSEMBL: ENSMUSP00000140566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404] [ENSMUST00000055223] [ENSMUST00000082158] [ENSMUST00000185403] [ENSMUST00000185654] [ENSMUST00000187058] [ENSMUST00000188290] [ENSMUST00000188346] [ENSMUST00000188931]
Predicted Effect probably benign
Transcript: ENSMUST00000027404
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect probably null
Transcript: ENSMUST00000055223
SMART Domains Protein: ENSMUSP00000052520
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000082158
SMART Domains Protein: ENSMUSP00000080796
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185403
SMART Domains Protein: ENSMUSP00000139982
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185654
SMART Domains Protein: ENSMUSP00000140456
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.3e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187058
SMART Domains Protein: ENSMUSP00000140637
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188290
SMART Domains Protein: ENSMUSP00000140634
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188346
SMART Domains Protein: ENSMUSP00000140588
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000140566
Gene: ENSMUSG00000026203
AA Change: G275D

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190445
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Dnajb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb2 APN 1 75236890 missense probably damaging 1.00
R0494:Dnajb2 UTSW 1 75239634 unclassified probably benign
R2118:Dnajb2 UTSW 1 75237477 missense probably damaging 1.00
R3837:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3838:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3839:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R4105:Dnajb2 UTSW 1 75236899 nonsense probably null
R4108:Dnajb2 UTSW 1 75236899 nonsense probably null
R4858:Dnajb2 UTSW 1 75243554 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTTGCAGGTGTCCCAGATG -3'
(R):5'- GTCGGGATCTGAATTAGTCCAGG -3'

Sequencing Primer
(F):5'- AGATGACCTGGCACTAGGCTTG -3'
(R):5'- GATCTGAATTAGTCCAGGCTCTGC -3'
Posted On2019-05-15