Mutagenetix > Incidental Mutation

Incidental Mutation 'R7115:Axdnd1'

551714

Institutional Source

Beutler Lab

Gene Symbol

Axdnd1

Ensembl Gene

ENSMUSG00000026601

Gene Name

axonemal dynein light chain domain containing 1

Synonyms

LOC381304, 9430070O13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R7115 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

156323509-156421159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 156380876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 267 (K267R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000177824
AA Change: K399R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: K399R

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178036
AA Change: K464R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: K464R

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213088
AA Change: K464R

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,437,725	I636N	probably benign	Het
Adam5	A	G	8: 24,781,696	I565T	possibly damaging	Het
Amd2	C	A	10: 35,711,637		probably benign	Het
Ap5m1	T	A	14: 49,086,270	Y472*	probably null	Het
Apcdd1	T	C	18: 62,936,953	F97S	probably damaging	Het
BC067074	T	G	13: 113,320,776	S1119A		Het
Carf	G	T	1: 60,148,150	L637F	probably damaging	Het
Ccdc103	A	T	11: 102,883,810	S95C	possibly damaging	Het
Cfap20	T	C	8: 95,421,246	I156V	probably benign	Het
Csn1s2a	T	C	5: 87,781,805	C96R	probably benign	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dennd2a	G	A	6: 39,506,711	T405M	probably damaging	Het
Dennd5a	A	G	7: 109,894,754	Y1248H	probably damaging	Het
Dnah14	A	T	1: 181,720,145	K2504N	probably damaging	Het
Dnajb2	G	A	1: 75,243,662	G275D		Het
Elf3	T	G	1: 135,257,118	D110A	probably damaging	Het
Eomes	A	G	9: 118,484,489	N534S	probably benign	Het
Fry	A	T	5: 150,386,067	R659W	probably damaging	Het
Gm10428	G	A	11: 62,753,380	C94Y	unknown	Het
Gm2696	T	A	10: 77,836,299	C111S	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Lrp1b	T	A	2: 40,998,235	N2338Y		Het
Map2k1	A	G	9: 64,212,606	I139T	probably damaging	Het
Olfr44	T	C	9: 39,484,648	I202V	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,707	Y79C	probably benign	Het
Pxylp1	G	A	9: 96,825,010	T373I	probably benign	Het
Ranbp9	T	C	13: 43,406,671	N484S	probably benign	Het
Rassf5	A	G	1: 131,181,249	V293A	probably benign	Het
Ring1	A	G	17: 34,023,446	I29T	probably damaging	Het
Scn1a	G	A	2: 66,324,618	Q666*	probably null	Het
Spice1	G	A	16: 44,379,275	G697R	probably benign	Het
Tas2r131	A	G	6: 132,957,604	F81L	probably benign	Het
Tenm2	G	A	11: 36,163,817	S572L	probably damaging	Het
Tfr2	A	G	5: 137,571,715	T128A	probably benign	Het
Trim56	T	A	5: 137,113,660	Q334L	probably damaging	Het
Vmn2r44	T	A	7: 8,367,528	R840*	probably null	Het

Other mutations in Axdnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03058:Axdnd1	APN	1	156376663	missense	probably benign	0.41
IGL03075:Axdnd1	APN	1	156395442	missense	probably damaging	1.00
IGL03165:Axdnd1	APN	1	156378389	missense	probably benign	0.00
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0739:Axdnd1	UTSW	1	156380886	missense	possibly damaging	0.73
R1087:Axdnd1	UTSW	1	156365689	missense	probably benign	0.08
R1350:Axdnd1	UTSW	1	156378380	critical splice donor site	probably null
R1488:Axdnd1	UTSW	1	156348960	missense	probably damaging	1.00
R1493:Axdnd1	UTSW	1	156346701	missense	probably benign	0.03
R1845:Axdnd1	UTSW	1	156376544	missense	possibly damaging	0.58
R1900:Axdnd1	UTSW	1	156380774	splice site	probably null
R2126:Axdnd1	UTSW	1	156333214	missense	probably benign	0.03
R2163:Axdnd1	UTSW	1	156392003	missense	probably damaging	1.00
R2169:Axdnd1	UTSW	1	156418309	missense	probably damaging	1.00
R2380:Axdnd1	UTSW	1	156365651	missense	probably benign	0.02
R2568:Axdnd1	UTSW	1	156392749	missense	possibly damaging	0.90
R3052:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3053:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3767:Axdnd1	UTSW	1	156380858	missense	probably damaging	1.00
R3927:Axdnd1	UTSW	1	156419270	missense	probably damaging	1.00
R3936:Axdnd1	UTSW	1	156331639	missense	probably benign	0.01
R4829:Axdnd1	UTSW	1	156376646	missense	possibly damaging	0.93
R4882:Axdnd1	UTSW	1	156395559	splice site	probably null
R4969:Axdnd1	UTSW	1	156395505	missense	possibly damaging	0.95
R5091:Axdnd1	UTSW	1	156420410	missense	possibly damaging	0.83
R5510:Axdnd1	UTSW	1	156335350	missense	probably benign	0.03
R5549:Axdnd1	UTSW	1	156398534	missense	probably damaging	1.00
R5587:Axdnd1	UTSW	1	156351412	missense	probably damaging	1.00
R5792:Axdnd1	UTSW	1	156341889	missense	probably damaging	0.99
R5840:Axdnd1	UTSW	1	156348958	missense	probably damaging	1.00
R6187:Axdnd1	UTSW	1	156365612	splice site	probably null
R6208:Axdnd1	UTSW	1	156392856	intron	probably benign
R6369:Axdnd1	UTSW	1	156392745	missense	probably damaging	1.00
R6493:Axdnd1	UTSW	1	156380813	missense	probably damaging	1.00
R7014:Axdnd1	UTSW	1	156330962	splice site	probably null
R7203:Axdnd1	UTSW	1	156382389	missense	probably damaging	0.98
R7352:Axdnd1	UTSW	1	156382477	missense	possibly damaging	0.91
R7447:Axdnd1	UTSW	1	156418232	critical splice donor site	probably null
R7470:Axdnd1	UTSW	1	156376516	missense
R7686:Axdnd1	UTSW	1	156395464	nonsense	probably null
R7793:Axdnd1	UTSW	1	156338743	critical splice donor site	probably null
R7809:Axdnd1	UTSW	1	156392801	nonsense	probably null
R7882:Axdnd1	UTSW	1	156397453	missense
R8256:Axdnd1	UTSW	1	156330666	missense	unknown
R8348:Axdnd1	UTSW	1	156418284	missense	probably benign	0.02
R8971:Axdnd1	UTSW	1	156391946	missense
R9207:Axdnd1	UTSW	1	156388046	missense
R9294:Axdnd1	UTSW	1	156420347	nonsense	probably null
X0009:Axdnd1	UTSW	1	156388079	missense	possibly damaging	0.61
X0067:Axdnd1	UTSW	1	156376535	missense	possibly damaging	0.67
Z1176:Axdnd1	UTSW	1	156349063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAAACAGTGCTCTGGACC -3'
(R):5'- TCCATGTAGCACAGAAAGCC -3'

Sequencing Primer
(F):5'- GCTCTGGACCAGCAATGAGTATTC -3'
(R):5'- AAAATGTCTTCTCAACTTTTGACCC -3'

Posted On

2019-05-15