Mutagenetix > Incidental Mutations

Incidental Mutation 'R7115:Scn1a'

551717

Institutional Source

Beutler Lab

Gene Symbol

Scn1a

Ensembl Gene

ENSMUSG00000064329

Gene Name

sodium channel, voltage-gated, type I, alpha

Synonyms

Nav1.1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7115 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66270778-66440840 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 66324618 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 666 (Q666*)

Ref Sequence

ENSEMBL: ENSMUSP00000107985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]

Predicted Effect

probably null
Transcript: ENSMUST00000077489
AA Change: Q666*

SMART Domains

Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: Q666*

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094951

SMART Domains

Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.3e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	691	2e-62	PFAM
Pfam:Ion_trans	774	963	6.7e-47	PFAM
Pfam:Na_trans_assoc	978	1200	1.2e-74	PFAM
Pfam:Ion_trans	1226	1454	1e-56	PFAM
PDB:1BYY\|A	1456	1508	4e-31	PDB
Pfam:Ion_trans	1547	1757	1.1e-51	PFAM
Pfam:PKD_channel	1606	1764	3.8e-7	PFAM
low complexity region	1809	1821	N/A	INTRINSIC
IQ	1886	1908	1.65e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112366
AA Change: Q666*

SMART Domains

Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: Q666*

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	127	434	2.8e-82	PFAM
Pfam:Na_trans_cytopl	502	718	2e-91	PFAM
Pfam:Ion_trans	767	1002	6.5e-57	PFAM
Pfam:Na_trans_assoc	1006	1213	1.2e-60	PFAM
Pfam:Ion_trans	1217	1493	3.3e-67	PFAM
Pfam:Ion_trans	1540	1797	6.3e-56	PFAM
Pfam:PKD_channel	1637	1791	1.1e-6	PFAM
low complexity region	1837	1849	N/A	INTRINSIC
IQ	1914	1936	1.65e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112371
AA Change: Q666*

SMART Domains

Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: Q666*

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
Pfam:Ion_trans	156	422	5.4e-77	PFAM
low complexity region	431	466	N/A	INTRINSIC
Pfam:DUF3451	484	708	5.5e-73	PFAM
Pfam:Ion_trans	791	980	6.8e-47	PFAM
Pfam:Na_trans_assoc	995	1217	1.2e-74	PFAM
Pfam:Ion_trans	1243	1471	1.1e-56	PFAM
PDB:1BYY\|A	1473	1525	4e-31	PDB
Pfam:Ion_trans	1564	1774	1.1e-51	PFAM
Pfam:PKD_channel	1623	1781	3.9e-7	PFAM
low complexity region	1826	1838	N/A	INTRINSIC
IQ	1903	1925	1.65e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138910

SMART Domains

Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329

Domain	Start	End	E-Value	Type
low complexity region	23	52	N/A	INTRINSIC
transmembrane domain	125	147	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,437,725	I636N	probably benign	Het
Adam5	A	G	8: 24,781,696	I565T	possibly damaging	Het
Amd2	C	A	10: 35,711,637		probably benign	Het
Ap5m1	T	A	14: 49,086,270	Y472*	probably null	Het
Apcdd1	T	C	18: 62,936,953	F97S	probably damaging	Het
Axdnd1	T	C	1: 156,380,876	K267R		Het
BC067074	T	G	13: 113,320,776	S1119A		Het
Carf	G	T	1: 60,148,150	L637F	probably damaging	Het
Ccdc103	A	T	11: 102,883,810	S95C	possibly damaging	Het
Cfap20	T	C	8: 95,421,246	I156V	probably benign	Het
Csn1s2a	T	C	5: 87,781,805	C96R	probably benign	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dennd2a	G	A	6: 39,506,711	T405M	probably damaging	Het
Dennd5a	A	G	7: 109,894,754	Y1248H	probably damaging	Het
Dnah14	A	T	1: 181,720,145	K2504N	probably damaging	Het
Dnajb2	G	A	1: 75,243,662	G275D		Het
Elf3	T	G	1: 135,257,118	D110A	probably damaging	Het
Eomes	A	G	9: 118,484,489	N534S	probably benign	Het
Fry	A	T	5: 150,386,067	R659W	probably damaging	Het
Gm10428	G	A	11: 62,753,380	C94Y	unknown	Het
Gm2696	T	A	10: 77,836,299	C111S	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Lrp1b	T	A	2: 40,998,235	N2338Y		Het
Map2k1	A	G	9: 64,212,606	I139T	probably damaging	Het
Olfr44	T	C	9: 39,484,648	I202V	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,707	Y79C	probably benign	Het
Pxylp1	G	A	9: 96,825,010	T373I	probably benign	Het
Ranbp9	T	C	13: 43,406,671	N484S	probably benign	Het
Rassf5	A	G	1: 131,181,249	V293A	probably benign	Het
Ring1	A	G	17: 34,023,446	I29T	probably damaging	Het
Spice1	G	A	16: 44,379,275	G697R	probably benign	Het
Tas2r131	A	G	6: 132,957,604	F81L	probably benign	Het
Tenm2	G	A	11: 36,163,817	S572L	probably damaging	Het
Tfr2	A	G	5: 137,571,715	T128A	probably benign	Het
Trim56	T	A	5: 137,113,660	Q334L	probably damaging	Het
Vmn2r44	T	A	7: 8,367,528	R840*	probably null	Het

Other mutations in Scn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Scn1a	APN	2	66335531	critical splice acceptor site	probably null
IGL00650:Scn1a	APN	2	66280793	missense	probably damaging	1.00
IGL00658:Scn1a	APN	2	66286038	missense	probably damaging	1.00
IGL00823:Scn1a	APN	2	66324935	missense	probably benign	0.04
IGL00907:Scn1a	APN	2	66327797	missense	probably damaging	1.00
IGL01339:Scn1a	APN	2	66325960	missense	probably benign	0.09
IGL01401:Scn1a	APN	2	66289111	missense	probably damaging	1.00
IGL01503:Scn1a	APN	2	66322343	missense	probably damaging	1.00
IGL01575:Scn1a	APN	2	66273236	missense	probably damaging	1.00
IGL01598:Scn1a	APN	2	66302485	missense	possibly damaging	0.63
IGL01613:Scn1a	APN	2	66285937	missense	probably damaging	1.00
IGL01796:Scn1a	APN	2	66332301	splice site	probably benign
IGL02079:Scn1a	APN	2	66323360	missense	probably benign	0.14
IGL02171:Scn1a	APN	2	66273199	missense	probably damaging	1.00
IGL02335:Scn1a	APN	2	66277661	missense	possibly damaging	0.93
IGL02406:Scn1a	APN	2	66326036	missense	possibly damaging	0.88
IGL02436:Scn1a	APN	2	66351153	missense	probably benign	0.01
IGL02507:Scn1a	APN	2	66277813	missense	probably damaging	1.00
IGL02646:Scn1a	APN	2	66299618	splice site	probably null
IGL02729:Scn1a	APN	2	66299650	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66324762	missense	probably damaging	1.00
IGL02740:Scn1a	APN	2	66318077	missense	probably benign	0.00
IGL02752:Scn1a	APN	2	66331412	missense	probably damaging	1.00
IGL02815:Scn1a	APN	2	66324858	missense	probably damaging	1.00
IGL03163:Scn1a	APN	2	66318074	missense	probably benign	0.00
IGL03229:Scn1a	APN	2	66299713	missense	probably damaging	1.00
IGL03286:Scn1a	APN	2	66277576	missense	probably damaging	0.99
IGL03393:Scn1a	APN	2	66318018	missense	probably benign	0.19
BB008:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
BB018:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
PIT4791001:Scn1a	UTSW	2	66273282	missense	probably benign	0.18
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0053:Scn1a	UTSW	2	66299775	missense	probably benign	0.05
R0107:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R0141:Scn1a	UTSW	2	66289062	missense	probably damaging	1.00
R0485:Scn1a	UTSW	2	66273925	missense	probably damaging	0.98
R0517:Scn1a	UTSW	2	66302407	missense	possibly damaging	0.88
R0532:Scn1a	UTSW	2	66317823	missense	probably damaging	1.00
R0746:Scn1a	UTSW	2	66351126	missense	probably benign	0.25
R0755:Scn1a	UTSW	2	66321035	missense	probably damaging	1.00
R0830:Scn1a	UTSW	2	66299784	missense	probably damaging	1.00
R0846:Scn1a	UTSW	2	66324755	missense	probably benign	0.43
R0918:Scn1a	UTSW	2	66323307	splice site	probably null
R1055:Scn1a	UTSW	2	66337996	missense	probably benign	0.08
R1432:Scn1a	UTSW	2	66322429	missense	probably damaging	1.00
R1497:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R1512:Scn1a	UTSW	2	66331285	missense	possibly damaging	0.82
R1525:Scn1a	UTSW	2	66319462	nonsense	probably null
R1567:Scn1a	UTSW	2	66273331	missense	probably damaging	1.00
R1702:Scn1a	UTSW	2	66318223	missense	probably damaging	1.00
R1744:Scn1a	UTSW	2	66322276	missense	probably benign	0.06
R1834:Scn1a	UTSW	2	66324616	missense	probably benign	0.04
R1834:Scn1a	UTSW	2	66324617	missense	probably benign	0.00
R1860:Scn1a	UTSW	2	66317982	missense	probably damaging	0.99
R1871:Scn1a	UTSW	2	66318025	missense	probably damaging	0.98
R1909:Scn1a	UTSW	2	66331352	missense	possibly damaging	0.58
R1967:Scn1a	UTSW	2	66328425	missense	probably damaging	1.00
R1976:Scn1a	UTSW	2	66331271	missense	probably benign	0.02
R2291:Scn1a	UTSW	2	66288968	missense	probably benign	0.44
R2302:Scn1a	UTSW	2	66277745	missense	probably damaging	1.00
R2367:Scn1a	UTSW	2	66327679	missense	probably damaging	1.00
R2418:Scn1a	UTSW	2	66273843	missense	probably damaging	0.98
R2517:Scn1a	UTSW	2	66273832	missense	probably damaging	1.00
R2568:Scn1a	UTSW	2	66273469	missense	probably damaging	1.00
R3083:Scn1a	UTSW	2	66299637	missense	probably damaging	1.00
R3903:Scn1a	UTSW	2	66318132	missense	probably benign	0.08
R3909:Scn1a	UTSW	2	66273988	missense	probably damaging	1.00
R3916:Scn1a	UTSW	2	66277613	missense	probably damaging	1.00
R3935:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R3936:Scn1a	UTSW	2	66327776	missense	probably damaging	0.99
R4043:Scn1a	UTSW	2	66326036	missense	possibly damaging	0.60
R4429:Scn1a	UTSW	2	66350985	missense	possibly damaging	0.77
R4495:Scn1a	UTSW	2	66280802	critical splice acceptor site	probably null
R4662:Scn1a	UTSW	2	66350988	missense	probably benign	0.23
R4834:Scn1a	UTSW	2	66328522	nonsense	probably null
R4873:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R4875:Scn1a	UTSW	2	66328476	missense	possibly damaging	0.92
R5099:Scn1a	UTSW	2	66277801	missense	probably damaging	1.00
R5255:Scn1a	UTSW	2	66277669	missense	probably damaging	0.99
R5435:Scn1a	UTSW	2	66273534	missense	probably damaging	1.00
R5449:Scn1a	UTSW	2	66321002	missense	probably damaging	0.96
R5519:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R5541:Scn1a	UTSW	2	66324633	missense	probably benign	0.07
R5556:Scn1a	UTSW	2	66324797	missense	probably benign	0.00
R5587:Scn1a	UTSW	2	66273081	missense	probably benign	0.01
R5972:Scn1a	UTSW	2	66351110	missense	possibly damaging	0.65
R5992:Scn1a	UTSW	2	66335456	missense	probably damaging	1.00
R6195:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6233:Scn1a	UTSW	2	66277618	missense	possibly damaging	0.59
R6328:Scn1a	UTSW	2	66273316	missense	probably damaging	1.00
R6417:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6420:Scn1a	UTSW	2	66273198	missense	probably damaging	1.00
R6421:Scn1a	UTSW	2	66272927	missense	probably damaging	1.00
R6461:Scn1a	UTSW	2	66326122	missense	probably null	0.01
R6701:Scn1a	UTSW	2	66337960	missense	probably damaging	0.99
R6717:Scn1a	UTSW	2	66332287	missense	probably damaging	1.00
R6834:Scn1a	UTSW	2	66327742	missense	probably damaging	1.00
R6918:Scn1a	UTSW	2	66332213	missense	probably damaging	1.00
R6953:Scn1a	UTSW	2	66319469	missense	probably damaging	1.00
R6996:Scn1a	UTSW	2	66287731	missense	probably damaging	1.00
R7022:Scn1a	UTSW	2	66317899	missense	probably damaging	1.00
R7109:Scn1a	UTSW	2	66350942	missense	possibly damaging	0.62
R7239:Scn1a	UTSW	2	66277656	splice site	probably null
R7434:Scn1a	UTSW	2	66273045	missense	probably benign
R7646:Scn1a	UTSW	2	66287758	missense	possibly damaging	0.93
R7711:Scn1a	UTSW	2	66303660	missense	probably benign
R7879:Scn1a	UTSW	2	66286005	nonsense	probably null
R7931:Scn1a	UTSW	2	66317812	missense	probably damaging	0.99
R7962:Scn1a	UTSW	2	66328442	missense	probably damaging	1.00
R8025:Scn1a	UTSW	2	66318213	missense	probably benign	0.02
R8055:Scn1a	UTSW	2	66319501	missense	probably damaging	1.00
R8095:Scn1a	UTSW	2	66302465	missense	possibly damaging	0.93
R8167:Scn1a	UTSW	2	66324838	missense	probably damaging	0.98
R8339:Scn1a	UTSW	2	66286029	missense	probably damaging	1.00
R8363:Scn1a	UTSW	2	66322257	missense	probably damaging	1.00
R8516:Scn1a	UTSW	2	66326134	missense	possibly damaging	0.79
Z1176:Scn1a	UTSW	2	66326128	missense	possibly damaging	0.92
Z1177:Scn1a	UTSW	2	66324952	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGCTACAAGATGCAGGTGC -3'
(R):5'- TGATGAACACAGCACCTTTGAG -3'

Sequencing Primer
(F):5'- AGGTGCATTCTCAGCTCGAC -3'
(R):5'- AGAGCCGTAGAGACTCACTGTTC -3'

Posted On

2019-05-15