Incidental Mutation 'R7115:Dennd2a'
ID551722
Institutional Source Beutler Lab
Gene Symbol Dennd2a
Ensembl Gene ENSMUSG00000038456
Gene NameDENN/MADD domain containing 2A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location39462378-39557867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39506711 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 405 (T405M)
Ref Sequence ENSEMBL: ENSMUSP00000045367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036877] [ENSMUST00000154149]
Predicted Effect probably damaging
Transcript: ENSMUST00000036877
AA Change: T405M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045367
Gene: ENSMUSG00000038456
AA Change: T405M

DomainStartEndE-ValueType
Blast:DENN 9 430 1e-149 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 508 520 N/A INTRINSIC
uDENN 554 646 2.06e-31 SMART
DENN 653 837 7.1e-76 SMART
dDENN 888 953 1.84e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154149
AA Change: T405M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116907
Gene: ENSMUSG00000038456
AA Change: T405M

DomainStartEndE-ValueType
Blast:DENN 9 420 1e-152 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Dennd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Dennd2a APN 6 39523136 missense probably damaging 1.00
IGL01482:Dennd2a APN 6 39480309 missense probably damaging 0.98
IGL02135:Dennd2a APN 6 39480271 nonsense probably null
IGL02206:Dennd2a APN 6 39523449 missense probably damaging 1.00
IGL02649:Dennd2a APN 6 39470356 missense probably benign 0.11
IGL03057:Dennd2a APN 6 39508248 missense probably damaging 0.98
R0310:Dennd2a UTSW 6 39464201 splice site probably benign
R0326:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R0360:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0364:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0394:Dennd2a UTSW 6 39522812 missense possibly damaging 0.92
R0680:Dennd2a UTSW 6 39483062 missense probably damaging 1.00
R1741:Dennd2a UTSW 6 39493157 missense probably damaging 0.99
R1744:Dennd2a UTSW 6 39480251 missense probably benign 0.26
R2070:Dennd2a UTSW 6 39465119 missense probably damaging 1.00
R3833:Dennd2a UTSW 6 39506717 missense probably damaging 0.97
R3833:Dennd2a UTSW 6 39506723 missense probably damaging 0.98
R4120:Dennd2a UTSW 6 39465096 missense probably damaging 0.99
R4583:Dennd2a UTSW 6 39522842 missense probably damaging 1.00
R4842:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R4887:Dennd2a UTSW 6 39497159 missense probably benign 0.03
R4901:Dennd2a UTSW 6 39522687 missense probably benign 0.00
R5065:Dennd2a UTSW 6 39495176 critical splice donor site probably null
R5413:Dennd2a UTSW 6 39464293 missense probably damaging 1.00
R6181:Dennd2a UTSW 6 39485620 missense probably benign 0.14
R6239:Dennd2a UTSW 6 39488816 missense probably damaging 1.00
R6360:Dennd2a UTSW 6 39493142 missense probably benign 0.01
R7419:Dennd2a UTSW 6 39523463 missense probably damaging 1.00
R7567:Dennd2a UTSW 6 39522809 missense probably benign
R7587:Dennd2a UTSW 6 39483135 missense probably damaging 1.00
R7662:Dennd2a UTSW 6 39493103 missense probably benign 0.03
R7781:Dennd2a UTSW 6 39493066 missense probably damaging 0.99
R7962:Dennd2a UTSW 6 39480273 missense possibly damaging 0.91
X0026:Dennd2a UTSW 6 39508367 missense possibly damaging 0.61
Z1177:Dennd2a UTSW 6 39523474 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TAATCCACGCTACACTCTGC -3'
(R):5'- GCCAAGATAGGGGCTTAGTG -3'

Sequencing Primer
(F):5'- CAAGATCTCACGGTCTTAGTCAGG -3'
(R):5'- CCAATGCCATGGGATTTGAC -3'
Posted On2019-05-15