Mutagenetix > Incidental Mutations

Incidental Mutation 'R7115:Adam5'

551726

Institutional Source

Beutler Lab

Gene Symbol

Adam5

Ensembl Gene

ENSMUSG00000031554

Gene Name

a disintegrin and metallopeptidase domain 5

Synonyms

tMDCII

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R7115 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24727093-24824369 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24781696 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 565 (I565T)

Ref Sequence

ENSEMBL: ENSMUSP00000052661 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000050300
AA Change: I565T

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: I565T

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:Pep_M12B_propep	16	142	1.6e-19	PFAM
Pfam:Reprolysin	185	378	7.7e-59	PFAM
DISIN	397	474	9.1e-42	SMART
ACR	475	618	6.9e-58	SMART
transmembrane domain	695	712	N/A	INTRINSIC
low complexity region	718	751	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118419
AA Change: I565T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: I565T

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:Pep_M12B_propep	16	142	4.7e-30	PFAM
Pfam:Reprolysin	185	378	7.9e-56	PFAM
DISIN	397	474	1.78e-39	SMART
ACR	475	618	2.06e-55	SMART
transmembrane domain	695	712	N/A	INTRINSIC
low complexity region	718	750	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: I482T

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	1	60	6.7e-14	PFAM
Pfam:Reprolysin	103	296	2.5e-61	PFAM
DISIN	315	392	1.78e-39	SMART
ACR	393	536	2.06e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000209935
AA Change: I565T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,437,725	I636N	probably benign	Het
Amd2	C	A	10: 35,711,637		probably benign	Het
Ap5m1	T	A	14: 49,086,270	Y472*	probably null	Het
Apcdd1	T	C	18: 62,936,953	F97S	probably damaging	Het
Axdnd1	T	C	1: 156,380,876	K267R		Het
BC067074	T	G	13: 113,320,776	S1119A		Het
Carf	G	T	1: 60,148,150	L637F	probably damaging	Het
Ccdc103	A	T	11: 102,883,810	S95C	possibly damaging	Het
Cfap20	T	C	8: 95,421,246	I156V	probably benign	Het
Csn1s2a	T	C	5: 87,781,805	C96R	probably benign	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dennd2a	G	A	6: 39,506,711	T405M	probably damaging	Het
Dennd5a	A	G	7: 109,894,754	Y1248H	probably damaging	Het
Dnah14	A	T	1: 181,720,145	K2504N	probably damaging	Het
Dnajb2	G	A	1: 75,243,662	G275D		Het
Elf3	T	G	1: 135,257,118	D110A	probably damaging	Het
Eomes	A	G	9: 118,484,489	N534S	probably benign	Het
Fry	A	T	5: 150,386,067	R659W	probably damaging	Het
Gm10428	G	A	11: 62,753,380	C94Y	unknown	Het
Gm2696	T	A	10: 77,836,299	C111S	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Lrp1b	T	A	2: 40,998,235	N2338Y		Het
Map2k1	A	G	9: 64,212,606	I139T	probably damaging	Het
Olfr44	T	C	9: 39,484,648	I202V	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,707	Y79C	probably benign	Het
Pxylp1	G	A	9: 96,825,010	T373I	probably benign	Het
Ranbp9	T	C	13: 43,406,671	N484S	probably benign	Het
Rassf5	A	G	1: 131,181,249	V293A	probably benign	Het
Ring1	A	G	17: 34,023,446	I29T	probably damaging	Het
Scn1a	G	A	2: 66,324,618	Q666*	probably null	Het
Spice1	G	A	16: 44,379,275	G697R	probably benign	Het
Tas2r131	A	G	6: 132,957,604	F81L	probably benign	Het
Tenm2	G	A	11: 36,163,817	S572L	probably damaging	Het
Tfr2	A	G	5: 137,571,715	T128A	probably benign	Het
Trim56	T	A	5: 137,113,660	Q334L	probably damaging	Het
Vmn2r44	T	A	7: 8,367,528	R840*	probably null	Het

Other mutations in Adam5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Adam5	APN	8	24818742	missense	probably benign	0.18
IGL01285:Adam5	APN	8	24781594	missense	probably benign	0.02
IGL01310:Adam5	APN	8	24742134	intron	probably benign
IGL01510:Adam5	APN	8	24804465	missense	probably damaging	1.00
IGL01570:Adam5	APN	8	24810823	missense	probably damaging	1.00
IGL02017:Adam5	APN	8	24781759	missense	probably benign	0.38
IGL02191:Adam5	APN	8	24812423	nonsense	probably null
IGL02397:Adam5	APN	8	24744133	intron	probably benign
IGL02488:Adam5	APN	8	24792006	missense	probably damaging	0.98
IGL02490:Adam5	APN	8	24781704	nonsense	probably null
IGL02499:Adam5	APN	8	24781565	critical splice donor site	probably null
IGL02539:Adam5	APN	8	24786213	nonsense	probably null
IGL02590:Adam5	APN	8	24744135	intron	probably benign
IGL02677:Adam5	APN	8	24812379	splice site	probably benign
IGL02679:Adam5	APN	8	24806526	missense	probably damaging	1.00
IGL02982:Adam5	APN	8	24804431	missense	probably benign	0.02
IGL03146:Adam5	APN	8	24804503	missense	probably damaging	0.98
IGL03162:Adam5	APN	8	24781604	missense	probably benign	0.30
IGL03284:Adam5	APN	8	24786338	splice site	probably benign
R0081:Adam5	UTSW	8	24781687	missense	probably damaging	1.00
R0377:Adam5	UTSW	8	24747541	missense	probably benign	0.08
R0398:Adam5	UTSW	8	24813432	missense	probably benign	0.17
R0771:Adam5	UTSW	8	24786299	missense	probably benign	0.04
R0925:Adam5	UTSW	8	24812425	missense	probably benign	0.09
R1547:Adam5	UTSW	8	24810713	missense	probably benign	0.10
R1985:Adam5	UTSW	8	24746739	missense	probably benign	0.01
R2115:Adam5	UTSW	8	24744145	intron	probably benign
R2125:Adam5	UTSW	8	24815118	missense	probably damaging	1.00
R2144:Adam5	UTSW	8	24815480	missense	probably benign	0.14
R3151:Adam5	UTSW	8	24781631	missense	probably damaging	0.99
R3612:Adam5	UTSW	8	24818089	splice site	probably benign
R3844:Adam5	UTSW	8	24813410	missense	probably benign	0.12
R3873:Adam5	UTSW	8	24815109	missense	probably benign	0.02
R4514:Adam5	UTSW	8	24818136	missense	probably damaging	1.00
R4843:Adam5	UTSW	8	24813536	missense	probably damaging	1.00
R4866:Adam5	UTSW	8	24742156	splice site	probably null
R4866:Adam5	UTSW	8	24781603	missense	probably damaging	0.98
R4900:Adam5	UTSW	8	24742156	splice site	probably null
R4900:Adam5	UTSW	8	24781603	missense	probably damaging	0.98
R4903:Adam5	UTSW	8	24786232	missense	probably damaging	1.00
R4936:Adam5	UTSW	8	24786271	missense	probably damaging	1.00
R4964:Adam5	UTSW	8	24786232	missense	probably damaging	1.00
R5259:Adam5	UTSW	8	24810834	missense	possibly damaging	0.90
R5293:Adam5	UTSW	8	24810706	missense	possibly damaging	0.46
R5724:Adam5	UTSW	8	24804495	nonsense	probably null
R5859:Adam5	UTSW	8	24813461	missense	probably benign
R6004:Adam5	UTSW	8	24781669	missense	probably benign	0.04
R6175:Adam5	UTSW	8	24786151	missense	probably benign	0.00
R6539:Adam5	UTSW	8	24782600	missense	possibly damaging	0.85
R6994:Adam5	UTSW	8	24786246	nonsense	probably null
R6996:Adam5	UTSW	8	24806501	missense	probably damaging	1.00
R7009:Adam5	UTSW	8	24806438	missense	probably benign	0.00
R7127:Adam5	UTSW	8	24810781	missense	probably damaging	1.00
R7469:Adam5	UTSW	8	24815525	missense	probably benign	0.45
R7780:Adam5	UTSW	8	24804416	missense	possibly damaging	0.49
R8027:Adam5	UTSW	8	24782558	missense	probably damaging	1.00
R8069:Adam5	UTSW	8	24813525	missense	probably damaging	1.00
R8138:Adam5	UTSW	8	24781762	missense	probably damaging	1.00
R8305:Adam5	UTSW	8	24810703	missense	possibly damaging	0.93
R8359:Adam5	UTSW	8	24806486	missense	probably damaging	1.00
R8480:Adam5	UTSW	8	24804459	nonsense	probably null
X0019:Adam5	UTSW	8	24812443	missense	probably benign	0.00
X0022:Adam5	UTSW	8	24813563	critical splice acceptor site	probably null
X0027:Adam5	UTSW	8	24818772	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACCTTTACACTGCAGAGGTG -3'
(R):5'- GTGGTTTTCCTAATGTGGAACC -3'

Sequencing Primer
(F):5'- CCACTAAAATACTCAGCTCTAGGTG -3'
(R):5'- CCTAATGTGGAACCTAAATTGCTAAC -3'

Posted On

2019-05-15