Incidental Mutation 'R7115:Pxylp1'
ID551732
Institutional Source Beutler Lab
Gene Symbol Pxylp1
Ensembl Gene ENSMUSG00000043587
Gene Name2-phosphoxylose phosphatase 1
Synonyms9430094M07Rik, Acpl2, C130099A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location96823336-96892669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96825010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 373 (T373I)
Ref Sequence ENSEMBL: ENSMUSP00000077571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078478] [ENSMUST00000112951] [ENSMUST00000119141] [ENSMUST00000120101] [ENSMUST00000121077] [ENSMUST00000126411]
Predicted Effect probably benign
Transcript: ENSMUST00000078478
AA Change: T373I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077571
Gene: ENSMUSG00000043587
AA Change: T373I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 1.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112951
AA Change: T373I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108574
Gene: ENSMUSG00000043587
AA Change: T373I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119141
AA Change: T373I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113489
Gene: ENSMUSG00000043587
AA Change: T373I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120101
AA Change: T373I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113210
Gene: ENSMUSG00000043587
AA Change: T373I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 2.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121077
SMART Domains Protein: ENSMUSP00000113059
Gene: ENSMUSG00000043587

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 180 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126411
SMART Domains Protein: ENSMUSP00000121537
Gene: ENSMUSG00000043587

DomainStartEndE-ValueType
Pfam:His_Phos_2 10 160 5e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Pxylp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Pxylp1 APN 9 96839143 missense probably damaging 1.00
IGL03031:Pxylp1 APN 9 96825142 missense probably benign 0.33
R4665:Pxylp1 UTSW 9 96825285 missense probably damaging 0.99
R5064:Pxylp1 UTSW 9 96854800 intron probably benign
R5749:Pxylp1 UTSW 9 96856371 missense possibly damaging 0.85
R5943:Pxylp1 UTSW 9 96839150 missense probably damaging 1.00
R5950:Pxylp1 UTSW 9 96839126 missense probably damaging 1.00
R6104:Pxylp1 UTSW 9 96824747 missense possibly damaging 0.80
R6334:Pxylp1 UTSW 9 96825254 missense probably damaging 0.99
R7057:Pxylp1 UTSW 9 96825050 missense probably benign 0.01
R7475:Pxylp1 UTSW 9 96856367 critical splice donor site probably null
R8258:Pxylp1 UTSW 9 96825580 missense probably benign 0.01
R8259:Pxylp1 UTSW 9 96825580 missense probably benign 0.01
R8307:Pxylp1 UTSW 9 96839084 critical splice donor site probably null
Z1176:Pxylp1 UTSW 9 96824956 missense probably damaging 1.00
Z1177:Pxylp1 UTSW 9 96824936 frame shift probably null
Z1177:Pxylp1 UTSW 9 96824937 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCAAGAGGACACATAGGCTTGG -3'
(R):5'- GCATGGAGCACTTCAAGGTG -3'

Sequencing Primer
(F):5'- AGAGCGCTTGTGGAAGTC -3'
(R):5'- GCACTTCAAGGTGATCAAGACGC -3'
Posted On2019-05-15