Incidental Mutation 'R7115:Ccdc103'
ID551738
Institutional Source Beutler Lab
Gene Symbol Ccdc103
Ensembl Gene ENSMUSG00000020930
Gene Namecoiled-coil domain containing 103
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102881204-102885216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102883810 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 95 (S95C)
Ref Sequence ENSEMBL: ENSMUSP00000125214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000021307] [ENSMUST00000067444] [ENSMUST00000100369] [ENSMUST00000107060] [ENSMUST00000159834]
Predicted Effect probably benign
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021307
SMART Domains Protein: ENSMUSP00000021307
Gene: ENSMUSG00000020930

DomainStartEndE-ValueType
Pfam:Dynein_attach_N 7 74 3.3e-32 PFAM
Pfam:RPAP3_C 98 188 1.2e-19 PFAM
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067444
SMART Domains Protein: ENSMUSP00000064691
Gene: ENSMUSG00000020932

DomainStartEndE-ValueType
Pfam:Filament_head 2 64 1.7e-8 PFAM
Filament 65 373 2.34e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100369
SMART Domains Protein: ENSMUSP00000097938
Gene: ENSMUSG00000075510

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 39 142 3.73e0 SMART
IG_like 275 361 1.61e1 SMART
transmembrane domain 377 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159834
AA Change: S95C

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125214
Gene: ENSMUSG00000020930
AA Change: S95C

DomainStartEndE-ValueType
coiled coil region 8 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Ccdc103
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1909:Ccdc103 UTSW 11 102882566 missense probably benign 0.20
R4073:Ccdc103 UTSW 11 102884099 missense probably damaging 1.00
R5000:Ccdc103 UTSW 11 102884106 missense probably benign 0.00
R5729:Ccdc103 UTSW 11 102883078 missense probably damaging 1.00
R6552:Ccdc103 UTSW 11 102884144 missense probably benign 0.01
R6774:Ccdc103 UTSW 11 102882693 missense probably damaging 1.00
X0026:Ccdc103 UTSW 11 102882582 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACCTTCAGATCCTAGCCTGG -3'
(R):5'- TAGCCAGGCTGTGCAGAATC -3'

Sequencing Primer
(F):5'- CAGATCCTAGCCTGGATTTCTTTGG -3'
(R):5'- TGTGCAGAATCCCCAGCACTG -3'
Posted On2019-05-15