Incidental Mutation 'R7115:Ranbp9'
ID551739
Institutional Source Beutler Lab
Gene Symbol Ranbp9
Ensembl Gene ENSMUSG00000038546
Gene NameRAN binding protein 9
SynonymsRanBPM, IBAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location43402675-43481282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43406671 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 484 (N484S)
Ref Sequence ENSEMBL: ENSMUSP00000152620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071926] [ENSMUST00000144326] [ENSMUST00000222651]
Predicted Effect probably benign
Transcript: ENSMUST00000071926
SMART Domains Protein: ENSMUSP00000071818
Gene: ENSMUSG00000063200

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
Pfam:NUC129 167 229 1.1e-34 PFAM
low complexity region 236 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144326
AA Change: N648S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130636
Gene: ENSMUSG00000038546
AA Change: N648S

DomainStartEndE-ValueType
low complexity region 2 114 N/A INTRINSIC
SPRY 194 315 1.66e-43 SMART
LisH 347 379 6.82e-5 SMART
CTLH 385 442 9.78e-15 SMART
low complexity region 455 478 N/A INTRINSIC
CRA 596 698 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221092
Predicted Effect probably benign
Transcript: ENSMUST00000222651
AA Change: N484S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000222754
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RAN, a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The protein encoded by this gene has also been shown to interact with several other proteins, including met proto-oncogene, homeodomain interacting protein kinase 2, androgen receptor, and cyclin-dependent kinase 11. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial neonatal lethality. Survivors display infertility with impaired spermatogenesis and oogenesis, azoospermia and premature ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Ap5m1 T A 14: 49,086,270 Y472* probably null Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Ranbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Ranbp9 APN 13 43480504 missense probably damaging 1.00
IGL01478:Ranbp9 APN 13 43414084 missense probably benign 0.31
IGL01948:Ranbp9 APN 13 43422553 missense probably damaging 1.00
IGL02177:Ranbp9 APN 13 43419717 missense probably damaging 0.99
IGL02382:Ranbp9 APN 13 43436146 splice site probably null
R0183:Ranbp9 UTSW 13 43425123 missense probably damaging 1.00
R0401:Ranbp9 UTSW 13 43422658 missense probably damaging 1.00
R0771:Ranbp9 UTSW 13 43461773 missense possibly damaging 0.92
R1551:Ranbp9 UTSW 13 43425117 missense probably benign 0.15
R1644:Ranbp9 UTSW 13 43412539 missense probably damaging 1.00
R1892:Ranbp9 UTSW 13 43416457 missense possibly damaging 0.87
R2247:Ranbp9 UTSW 13 43412425 missense probably damaging 1.00
R4097:Ranbp9 UTSW 13 43421257 missense probably damaging 0.97
R4794:Ranbp9 UTSW 13 43414076 missense probably damaging 0.99
R4908:Ranbp9 UTSW 13 43421257 missense possibly damaging 0.81
R4996:Ranbp9 UTSW 13 43425094 nonsense probably null
R5024:Ranbp9 UTSW 13 43434855 missense probably damaging 0.99
R5422:Ranbp9 UTSW 13 43419626 missense probably benign 0.01
R7069:Ranbp9 UTSW 13 43419622 missense probably benign 0.24
R7298:Ranbp9 UTSW 13 43480460 missense probably benign 0.10
R7382:Ranbp9 UTSW 13 43425114 missense probably damaging 0.99
X0024:Ranbp9 UTSW 13 43425085 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCATGTAATCTGTTCAGTATGGAGG -3'
(R):5'- AAGTGGAAGCCAGTTAGACTTTG -3'

Sequencing Primer
(F):5'- TTCAGTATGGAGGAAATTTTCTGC -3'
(R):5'- AAGCCAGTTAGACTTTGCTGTG -3'
Posted On2019-05-15