Mutagenetix > Incidental Mutation

Incidental Mutation 'R7115:BC067074'

551740

Institutional Source

Beutler Lab

Gene Symbol

BC067074

Ensembl Gene

ENSMUSG00000021763

Gene Name

cDNA sequence BC067074

Synonyms

MMRRC Submission

045206-MU

Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R7115 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

113293159-113379711 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 113320776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 1119 (S1119A)

Ref Sequence

ENSEMBL: ENSMUSP00000119993 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000136755]

AlphaFold

F6RXI4

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: S1119A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LamG	44	177	1.28e-20	SMART
LamG	229	371	4.66e-14	SMART
low complexity region	407	420	N/A	INTRINSIC
Pfam:Cadherin_3	492	644	2.1e-35	PFAM
Pfam:Cadherin_3	647	759	1e-7	PFAM
Pfam:Cadherin_3	741	873	1.2e-8	PFAM
Pfam:Cadherin_3	861	989	4.1e-14	PFAM
Pfam:Cadherin_3	958	1114	1.2e-20	PFAM
Pfam:Cadherin_3	1117	1223	1.6e-10	PFAM
Pfam:Cadherin_3	1212	1341	5.6e-12	PFAM
Pfam:Cadherin_3	1347	1438	3.8e-8	PFAM
Pfam:Cadherin_3	1419	1562	2.3e-45	PFAM
Pfam:Cadherin_3	1576	1679	2.1e-9	PFAM
low complexity region	1732	1740	N/A	INTRINSIC
Pfam:Cadherin_3	1773	1926	3e-35	PFAM
transmembrane domain	2267	2289	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,437,725	I636N	probably benign	Het
Adam5	A	G	8: 24,781,696	I565T	possibly damaging	Het
Amd2	C	A	10: 35,711,637		probably benign	Het
Ap5m1	T	A	14: 49,086,270	Y472*	probably null	Het
Apcdd1	T	C	18: 62,936,953	F97S	probably damaging	Het
Axdnd1	T	C	1: 156,380,876	K267R		Het
Carf	G	T	1: 60,148,150	L637F	probably damaging	Het
Ccdc103	A	T	11: 102,883,810	S95C	possibly damaging	Het
Cfap20	T	C	8: 95,421,246	I156V	probably benign	Het
Csn1s2a	T	C	5: 87,781,805	C96R	probably benign	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dennd2a	G	A	6: 39,506,711	T405M	probably damaging	Het
Dennd5a	A	G	7: 109,894,754	Y1248H	probably damaging	Het
Dnah14	A	T	1: 181,720,145	K2504N	probably damaging	Het
Dnajb2	G	A	1: 75,243,662	G275D		Het
Elf3	T	G	1: 135,257,118	D110A	probably damaging	Het
Eomes	A	G	9: 118,484,489	N534S	probably benign	Het
Fry	A	T	5: 150,386,067	R659W	probably damaging	Het
Gm10428	G	A	11: 62,753,380	C94Y	unknown	Het
Gm2696	T	A	10: 77,836,299	C111S	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Lrp1b	T	A	2: 40,998,235	N2338Y		Het
Map2k1	A	G	9: 64,212,606	I139T	probably damaging	Het
Olfr44	T	C	9: 39,484,648	I202V	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,707	Y79C	probably benign	Het
Pxylp1	G	A	9: 96,825,010	T373I	probably benign	Het
Ranbp9	T	C	13: 43,406,671	N484S	probably benign	Het
Rassf5	A	G	1: 131,181,249	V293A	probably benign	Het
Ring1	A	G	17: 34,023,446	I29T	probably damaging	Het
Scn1a	G	A	2: 66,324,618	Q666*	probably null	Het
Spice1	G	A	16: 44,379,275	G697R	probably benign	Het
Tas2r131	A	G	6: 132,957,604	F81L	probably benign	Het
Tenm2	G	A	11: 36,163,817	S572L	probably damaging	Het
Tfr2	A	G	5: 137,571,715	T128A	probably benign	Het
Trim56	T	A	5: 137,113,660	Q334L	probably damaging	Het
Vmn2r44	T	A	7: 8,367,528	R840*	probably null	Het

Other mutations in BC067074

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01723:BC067074	APN	13	113367557	missense	possibly damaging	0.91
IGL03023:BC067074	APN	13	113351741	missense	probably benign	0.03
cumpleanos	UTSW	13	113368336	missense	possibly damaging	0.87
Sorpresa	UTSW	13	113318191	missense	probably damaging	1.00
P0018:BC067074	UTSW	13	113367506	missense	possibly damaging	0.60
R0003:BC067074	UTSW	13	113368776	missense	probably benign	0.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0158:BC067074	UTSW	13	113369153	nonsense	probably null
R0281:BC067074	UTSW	13	113369143	missense	probably damaging	1.00
R1212:BC067074	UTSW	13	113369417	intron	probably benign
R1300:BC067074	UTSW	13	113366160	missense	probably damaging	1.00
R1434:BC067074	UTSW	13	113368492	missense	possibly damaging	0.46
R1509:BC067074	UTSW	13	113368256	missense	probably damaging	0.99
R1738:BC067074	UTSW	13	113367500	missense	possibly damaging	0.69
R1758:BC067074	UTSW	13	113368732	missense	possibly damaging	0.78
R1828:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R2061:BC067074	UTSW	13	113318094	missense	probably damaging	0.99
R2570:BC067074	UTSW	13	113318587	missense	probably benign	0.34
R2884:BC067074	UTSW	13	113320682	missense	probably damaging	1.00
R2884:BC067074	UTSW	13	113369191	missense	probably benign	0.00
R3004:BC067074	UTSW	13	113366154	missense	probably damaging	1.00
R3150:BC067074	UTSW	13	113351760	missense	probably damaging	1.00
R3773:BC067074	UTSW	13	113318209	missense	probably benign	0.12
R3864:BC067074	UTSW	13	113322951	missense	possibly damaging	0.64
R3971:BC067074	UTSW	13	113317126	missense	probably damaging	1.00
R4004:BC067074	UTSW	13	113318380	missense	probably benign	0.00
R4271:BC067074	UTSW	13	113342370	missense	possibly damaging	0.76
R4382:BC067074	UTSW	13	113322754	missense	probably benign	0.10
R4484:BC067074	UTSW	13	113319199	missense	probably damaging	0.98
R4570:BC067074	UTSW	13	113318191	missense	probably damaging	1.00
R4600:BC067074	UTSW	13	113319249	missense	possibly damaging	0.95
R4622:BC067074	UTSW	13	113320081	missense	probably benign	0.00
R4676:BC067074	UTSW	13	113368807	missense	probably damaging	0.98
R4676:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R4677:BC067074	UTSW	13	113379486	missense	unknown
R4775:BC067074	UTSW	13	113317695	missense	possibly damaging	0.91
R4779:BC067074	UTSW	13	113368336	missense	possibly damaging	0.87
R4780:BC067074	UTSW	13	113317858	missense	probably damaging	1.00
R4829:BC067074	UTSW	13	113368162	missense	probably benign	0.05
R4841:BC067074	UTSW	13	113366190	missense	probably benign	0.00
R4879:BC067074	UTSW	13	113319787	missense	probably benign	0.03
R4930:BC067074	UTSW	13	113327662	missense	probably damaging	1.00
R4934:BC067074	UTSW	13	113368348	missense	probably damaging	1.00
R4987:BC067074	UTSW	13	113318101	missense	probably benign	0.07
R5065:BC067074	UTSW	13	113320919	missense	probably benign	0.01
R5216:BC067074	UTSW	13	113342413	missense	probably benign	0.20
R5236:BC067074	UTSW	13	113366220	missense	probably benign	0.14
R5247:BC067074	UTSW	13	113319459	missense	probably damaging	1.00
R5250:BC067074	UTSW	13	113319771	missense	possibly damaging	0.95
R5337:BC067074	UTSW	13	113318765	missense	probably damaging	1.00
R5342:BC067074	UTSW	13	113366269	critical splice donor site	probably null
R5426:BC067074	UTSW	13	113369053	missense	probably benign	0.01
R5472:BC067074	UTSW	13	113319169	missense	probably benign	0.12
R5526:BC067074	UTSW	13	113367893	missense	probably benign	0.22
R5543:BC067074	UTSW	13	113320873	missense	probably damaging	0.96
R5589:BC067074	UTSW	13	113317950	missense	possibly damaging	0.95
R5623:BC067074	UTSW	13	113346634	missense	possibly damaging	0.95
R5668:BC067074	UTSW	13	113317167	missense	possibly damaging	0.55
R5793:BC067074	UTSW	13	113321022	missense	possibly damaging	0.75
R5824:BC067074	UTSW	13	113368620	missense	probably damaging	1.00
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6053:BC067074	UTSW	13	113320726	missense	possibly damaging	0.51
R6125:BC067074	UTSW	13	113317683	missense	probably benign	0.00
R6129:BC067074	UTSW	13	113368806	nonsense	probably null
R6290:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6291:BC067074	UTSW	13	113320447	missense	possibly damaging	0.85
R6302:BC067074	UTSW	13	113368112	missense	probably damaging	1.00
R6317:BC067074	UTSW	13	113368268	missense	probably benign	0.09
R6395:BC067074	UTSW	13	113369469	missense	probably damaging	1.00
R6673:BC067074	UTSW	13	113367832	nonsense	probably null
R6783:BC067074	UTSW	13	113320209	nonsense	probably null
R6800:BC067074	UTSW	13	113368152	missense	probably benign	0.02
R6857:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6889:BC067074	UTSW	13	113318378	missense	probably damaging	0.99
R6934:BC067074	UTSW	13	113369266	missense	probably benign
R7019:BC067074	UTSW	13	113351750	missense	probably benign	0.01
R7100:BC067074	UTSW	13	113318967	missense
R7152:BC067074	UTSW	13	113318850	missense
R7195:BC067074	UTSW	13	113367929	missense
R7213:BC067074	UTSW	13	113317941	missense
R7250:BC067074	UTSW	13	113318815	missense
R7341:BC067074	UTSW	13	113318172	missense
R7358:BC067074	UTSW	13	113319967	missense
R7359:BC067074	UTSW	13	113342430	missense
R7396:BC067074	UTSW	13	113318990	missense
R7632:BC067074	UTSW	13	113320886	missense
R7689:BC067074	UTSW	13	113379414	missense
R7713:BC067074	UTSW	13	113346541	missense
R7892:BC067074	UTSW	13	113319606	missense
R7975:BC067074	UTSW	13	113319307	missense
R8017:BC067074	UTSW	13	113319623	missense
R8019:BC067074	UTSW	13	113319623	missense
R8034:BC067074	UTSW	13	113342511	missense
R8101:BC067074	UTSW	13	113320891	missense
R8104:BC067074	UTSW	13	113319729	missense
R8122:BC067074	UTSW	13	113318908	missense
R8126:BC067074	UTSW	13	113368163	missense
R8272:BC067074	UTSW	13	113368355	missense
R8679:BC067074	UTSW	13	113351629	missense
R8973:BC067074	UTSW	13	113319759	missense
R9123:BC067074	UTSW	13	113368840	missense
R9125:BC067074	UTSW	13	113368840	missense
R9182:BC067074	UTSW	13	113320824	missense
R9233:BC067074	UTSW	13	113366220	missense
R9264:BC067074	UTSW	13	113319480	missense
R9306:BC067074	UTSW	13	113369476	missense	unknown
R9327:BC067074	UTSW	13	113317176	missense
R9411:BC067074	UTSW	13	113368233	missense
R9516:BC067074	UTSW	13	113319115	missense
R9562:BC067074	UTSW	13	113368040	missense
R9605:BC067074	UTSW	13	113319969	missense

Predicted Primers

PCR Primer
(F):5'- GACATAGATTTTGACGATGGCC -3'
(R):5'- TTGTTGACCAGGAGTCTGCC -3'

Sequencing Primer
(F):5'- TGACGATGGCCAGTTGCTCTAC -3'
(R):5'- ACCAGGAGTCTGCCATGTTTTG -3'

Posted On

2019-05-15