Incidental Mutation 'R7115:Ap5m1'
ID551741
Institutional Source Beutler Lab
Gene Symbol Ap5m1
Ensembl Gene ENSMUSG00000036291
Gene Nameadaptor-related protein complex 5, mu 1 subunit
SynonymsMudeng, 4932432K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7115 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location49066097-49094234 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 49086270 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 472 (Y472*)
Ref Sequence ENSEMBL: ENSMUSP00000046536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037473] [ENSMUST00000227410] [ENSMUST00000227431] [ENSMUST00000227608]
Predicted Effect probably null
Transcript: ENSMUST00000037473
AA Change: Y472*
SMART Domains Protein: ENSMUSP00000046536
Gene: ENSMUSG00000036291
AA Change: Y472*

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
Pfam:Adap_comp_sub 196 476 3.2e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226695
AA Change: Y41*
Predicted Effect probably null
Transcript: ENSMUST00000227066
AA Change: Y82*
Predicted Effect probably benign
Transcript: ENSMUST00000227410
Predicted Effect probably benign
Transcript: ENSMUST00000227431
Predicted Effect probably benign
Transcript: ENSMUST00000227608
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,437,725 I636N probably benign Het
Adam5 A G 8: 24,781,696 I565T possibly damaging Het
Amd2 C A 10: 35,711,637 probably benign Het
Apcdd1 T C 18: 62,936,953 F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 K267R Het
BC067074 T G 13: 113,320,776 S1119A Het
Carf G T 1: 60,148,150 L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 I156V probably benign Het
Csn1s2a T C 5: 87,781,805 C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dennd2a G A 6: 39,506,711 T405M probably damaging Het
Dennd5a A G 7: 109,894,754 Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 G275D Het
Elf3 T G 1: 135,257,118 D110A probably damaging Het
Eomes A G 9: 118,484,489 N534S probably benign Het
Fry A T 5: 150,386,067 R659W probably damaging Het
Gm10428 G A 11: 62,753,380 C94Y unknown Het
Gm2696 T A 10: 77,836,299 C111S unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Lrp1b T A 2: 40,998,235 N2338Y Het
Map2k1 A G 9: 64,212,606 I139T probably damaging Het
Olfr44 T C 9: 39,484,648 I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 T373I probably benign Het
Ranbp9 T C 13: 43,406,671 N484S probably benign Het
Rassf5 A G 1: 131,181,249 V293A probably benign Het
Ring1 A G 17: 34,023,446 I29T probably damaging Het
Scn1a G A 2: 66,324,618 Q666* probably null Het
Spice1 G A 16: 44,379,275 G697R probably benign Het
Tas2r131 A G 6: 132,957,604 F81L probably benign Het
Tenm2 G A 11: 36,163,817 S572L probably damaging Het
Tfr2 A G 5: 137,571,715 T128A probably benign Het
Trim56 T A 5: 137,113,660 Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 R840* probably null Het
Other mutations in Ap5m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Ap5m1 APN 14 49073790 missense probably damaging 1.00
IGL01806:Ap5m1 APN 14 49080340 missense probably damaging 1.00
IGL02011:Ap5m1 APN 14 49081135 unclassified probably benign
IGL02165:Ap5m1 APN 14 49078728 missense possibly damaging 0.94
IGL02203:Ap5m1 APN 14 49080258 missense probably damaging 1.00
IGL02950:Ap5m1 APN 14 49073935 missense probably benign 0.44
IGL03123:Ap5m1 APN 14 49073761 missense probably damaging 1.00
IGL03368:Ap5m1 APN 14 49081136 unclassified probably benign
R1688:Ap5m1 UTSW 14 49080834 critical splice acceptor site probably null
R2113:Ap5m1 UTSW 14 49086248 missense probably damaging 1.00
R2184:Ap5m1 UTSW 14 49086295 missense probably damaging 1.00
R2220:Ap5m1 UTSW 14 49081095 missense probably damaging 1.00
R2971:Ap5m1 UTSW 14 49083882 nonsense probably null
R3425:Ap5m1 UTSW 14 49073683 missense probably damaging 0.99
R4506:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R4679:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R4799:Ap5m1 UTSW 14 49081070 missense probably benign 0.08
R6365:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R6834:Ap5m1 UTSW 14 49073737 missense probably damaging 0.99
R7224:Ap5m1 UTSW 14 49080927 missense unknown
R7383:Ap5m1 UTSW 14 49074196 missense possibly damaging 0.77
R7539:Ap5m1 UTSW 14 49073557 missense probably damaging 1.00
R7866:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7897:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
R7949:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7980:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTCCATTAGAAGTACAACTAGAGATG -3'
(R):5'- CTGGCATGAAATCAGAGCATCG -3'

Sequencing Primer
(F):5'- CATATAAGTTTCAGTGTGGTTTACCC -3'
(R):5'- TGAAATCAGAGCATCGTAACAATGAC -3'
Posted On2019-05-15