Incidental Mutation 'R7115:Abcc1'
ID 551742
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Synonyms Mrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 045206-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R7115 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 14361558-14475737 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14437725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 636 (I636N)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
AlphaFold O35379
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: I636N

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: I636N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
AA Change: I636N

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: I636N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
AA Change: I636N

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: I636N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147759
AA Change: I636N

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: I636N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,696 (GRCm38) I565T possibly damaging Het
Amd2 C A 10: 35,711,637 (GRCm38) probably benign Het
Ap5m1 T A 14: 49,086,270 (GRCm38) Y472* probably null Het
Apcdd1 T C 18: 62,936,953 (GRCm38) F97S probably damaging Het
Axdnd1 T C 1: 156,380,876 (GRCm38) K267R Het
BC067074 T G 13: 113,320,776 (GRCm38) S1119A Het
Carf G T 1: 60,148,150 (GRCm38) L637F probably damaging Het
Ccdc103 A T 11: 102,883,810 (GRCm38) S95C possibly damaging Het
Cfap20 T C 8: 95,421,246 (GRCm38) I156V probably benign Het
Csn1s2a T C 5: 87,781,805 (GRCm38) C96R probably benign Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 (GRCm38) probably benign Het
Dennd2a G A 6: 39,506,711 (GRCm38) T405M probably damaging Het
Dennd5a A G 7: 109,894,754 (GRCm38) Y1248H probably damaging Het
Dnah14 A T 1: 181,720,145 (GRCm38) K2504N probably damaging Het
Dnajb2 G A 1: 75,243,662 (GRCm38) G275D Het
Elf3 T G 1: 135,257,118 (GRCm38) D110A probably damaging Het
Eomes A G 9: 118,484,489 (GRCm38) N534S probably benign Het
Fry A T 5: 150,386,067 (GRCm38) R659W probably damaging Het
Gm10428 G A 11: 62,753,380 (GRCm38) C94Y unknown Het
Gm2696 T A 10: 77,836,299 (GRCm38) C111S unknown Het
Gpt2 G A 8: 85,518,052 (GRCm38) E325K probably benign Het
Lrp1b T A 2: 40,998,235 (GRCm38) N2338Y Het
Map2k1 A G 9: 64,212,606 (GRCm38) I139T probably damaging Het
Olfr44 T C 9: 39,484,648 (GRCm38) I202V probably benign Het
Olfr964-ps1 T C 9: 39,686,707 (GRCm38) Y79C probably benign Het
Pxylp1 G A 9: 96,825,010 (GRCm38) T373I probably benign Het
Ranbp9 T C 13: 43,406,671 (GRCm38) N484S probably benign Het
Rassf5 A G 1: 131,181,249 (GRCm38) V293A probably benign Het
Ring1 A G 17: 34,023,446 (GRCm38) I29T probably damaging Het
Scn1a G A 2: 66,324,618 (GRCm38) Q666* probably null Het
Spice1 G A 16: 44,379,275 (GRCm38) G697R probably benign Het
Tas2r131 A G 6: 132,957,604 (GRCm38) F81L probably benign Het
Tenm2 G A 11: 36,163,817 (GRCm38) S572L probably damaging Het
Tfr2 A G 5: 137,571,715 (GRCm38) T128A probably benign Het
Trim56 T A 5: 137,113,660 (GRCm38) Q334L probably damaging Het
Vmn2r44 T A 7: 8,367,528 (GRCm38) R840* probably null Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14,460,983 (GRCm38) missense probably benign 0.34
IGL00094:Abcc1 APN 16 14,470,534 (GRCm38) missense probably null 0.00
IGL00475:Abcc1 APN 16 14,436,573 (GRCm38) missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14,413,312 (GRCm38) nonsense probably null
IGL00765:Abcc1 APN 16 14,411,508 (GRCm38) missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14,410,926 (GRCm38) missense probably benign 0.18
IGL01678:Abcc1 APN 16 14,405,019 (GRCm38) missense probably null 0.96
IGL01683:Abcc1 APN 16 14,396,424 (GRCm38) missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14,410,795 (GRCm38) missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14,411,519 (GRCm38) missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14,396,351 (GRCm38) missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14,467,979 (GRCm38) splice site probably benign
IGL02431:Abcc1 APN 16 14,419,734 (GRCm38) missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14,404,005 (GRCm38) missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14,466,126 (GRCm38) missense probably benign 0.00
IGL02902:Abcc1 APN 16 14,423,127 (GRCm38) missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14,389,868 (GRCm38) missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14,457,947 (GRCm38) missense probably benign
IGL03308:Abcc1 APN 16 14,470,611 (GRCm38) missense possibly damaging 0.55
gloom UTSW 16 14,411,616 (GRCm38) missense probably damaging 1.00
loom UTSW 16 14,472,930 (GRCm38) missense probably damaging 0.96
PIT4544001:Abcc1 UTSW 16 14,405,079 (GRCm38) missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14,410,927 (GRCm38) missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14,389,880 (GRCm38) missense probably benign 0.05
R0894:Abcc1 UTSW 16 14,465,137 (GRCm38) missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14,389,985 (GRCm38) critical splice donor site probably null
R1367:Abcc1 UTSW 16 14,443,386 (GRCm38) missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14,448,434 (GRCm38) missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14,413,368 (GRCm38) missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14,465,137 (GRCm38) missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14,423,117 (GRCm38) missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14,445,449 (GRCm38) missense probably benign 0.02
R1959:Abcc1 UTSW 16 14,396,393 (GRCm38) missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14,396,393 (GRCm38) missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14,461,204 (GRCm38) missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14,472,068 (GRCm38) missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14,467,923 (GRCm38) missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14,473,009 (GRCm38) splice site probably null
R2876:Abcc1 UTSW 16 14,457,960 (GRCm38) missense probably benign
R3003:Abcc1 UTSW 16 14,436,529 (GRCm38) missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14,396,399 (GRCm38) missense probably benign 0.00
R4119:Abcc1 UTSW 16 14,394,013 (GRCm38) missense probably benign 0.43
R4191:Abcc1 UTSW 16 14,389,864 (GRCm38) missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14,460,993 (GRCm38) missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14,445,300 (GRCm38) missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14,394,031 (GRCm38) missense probably benign 0.00
R4779:Abcc1 UTSW 16 14,410,771 (GRCm38) missense probably benign 0.35
R5027:Abcc1 UTSW 16 14,404,053 (GRCm38) critical splice donor site probably null
R5275:Abcc1 UTSW 16 14,466,186 (GRCm38) missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14,461,132 (GRCm38) missense probably benign 0.02
R5490:Abcc1 UTSW 16 14,410,917 (GRCm38) missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14,460,978 (GRCm38) missense probably benign 0.18
R5641:Abcc1 UTSW 16 14,472,013 (GRCm38) missense probably benign 0.00
R5642:Abcc1 UTSW 16 14,443,455 (GRCm38) missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14,467,037 (GRCm38) missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14,465,142 (GRCm38) missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14,460,916 (GRCm38) missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14,465,056 (GRCm38) missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14,447,490 (GRCm38) missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14,411,616 (GRCm38) missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14,413,383 (GRCm38) critical splice donor site probably null
R7187:Abcc1 UTSW 16 14,466,997 (GRCm38) missense probably benign
R7298:Abcc1 UTSW 16 14,396,472 (GRCm38) missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14,465,169 (GRCm38) missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14,472,986 (GRCm38) missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14,389,899 (GRCm38) nonsense probably null
R7583:Abcc1 UTSW 16 14,404,038 (GRCm38) missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14,445,419 (GRCm38) missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14,448,579 (GRCm38) missense probably benign
R8048:Abcc1 UTSW 16 14,410,844 (GRCm38) missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14,472,887 (GRCm38) missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14,472,930 (GRCm38) missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14,396,451 (GRCm38) missense probably damaging 1.00
R8859:Abcc1 UTSW 16 14,396,361 (GRCm38) missense probably benign 0.00
R8980:Abcc1 UTSW 16 14,461,097 (GRCm38) missense probably damaging 0.99
R9480:Abcc1 UTSW 16 14,394,025 (GRCm38) missense probably damaging 1.00
R9519:Abcc1 UTSW 16 14,389,817 (GRCm38) missense probably benign
R9653:Abcc1 UTSW 16 14,396,393 (GRCm38) missense probably damaging 1.00
R9708:Abcc1 UTSW 16 14,436,553 (GRCm38) missense probably damaging 1.00
R9725:Abcc1 UTSW 16 14,472,933 (GRCm38) missense possibly damaging 0.52
R9786:Abcc1 UTSW 16 14,405,063 (GRCm38) missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14,459,902 (GRCm38) missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14,410,809 (GRCm38) missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14,411,493 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTTCCAAATCCCATTGTAGGAG -3'
(R):5'- TGTCACTCACACTGCAGGAG -3'

Sequencing Primer
(F):5'- AGGAAGCCCCTACCTTTCATGTAG -3'
(R):5'- GCATGGAGGGAACAACAAAAATC -3'
Posted On 2019-05-15