Mutagenetix > Incidental Mutations

Incidental Mutation 'R7115:Apcdd1'

551745

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R7115 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62936953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 97 (F97S)

Ref Sequence

ENSEMBL: ENSMUSP00000094302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably damaging
Transcript: ENSMUST00000096554
AA Change: F97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: F97S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163716
AA Change: F97S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: F97S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,437,725	I636N	probably benign	Het
Adam5	A	G	8: 24,781,696	I565T	possibly damaging	Het
Amd2	C	A	10: 35,711,637		probably benign	Het
Ap5m1	T	A	14: 49,086,270	Y472*	probably null	Het
Axdnd1	T	C	1: 156,380,876	K267R		Het
BC067074	T	G	13: 113,320,776	S1119A		Het
Carf	G	T	1: 60,148,150	L637F	probably damaging	Het
Ccdc103	A	T	11: 102,883,810	S95C	possibly damaging	Het
Cfap20	T	C	8: 95,421,246	I156V	probably benign	Het
Csn1s2a	T	C	5: 87,781,805	C96R	probably benign	Het
Ctif	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC	18: 75,471,803		probably benign	Het
Dennd2a	G	A	6: 39,506,711	T405M	probably damaging	Het
Dennd5a	A	G	7: 109,894,754	Y1248H	probably damaging	Het
Dnah14	A	T	1: 181,720,145	K2504N	probably damaging	Het
Dnajb2	G	A	1: 75,243,662	G275D		Het
Elf3	T	G	1: 135,257,118	D110A	probably damaging	Het
Eomes	A	G	9: 118,484,489	N534S	probably benign	Het
Fry	A	T	5: 150,386,067	R659W	probably damaging	Het
Gm10428	G	A	11: 62,753,380	C94Y	unknown	Het
Gm2696	T	A	10: 77,836,299	C111S	unknown	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Lrp1b	T	A	2: 40,998,235	N2338Y		Het
Map2k1	A	G	9: 64,212,606	I139T	probably damaging	Het
Olfr44	T	C	9: 39,484,648	I202V	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,707	Y79C	probably benign	Het
Pxylp1	G	A	9: 96,825,010	T373I	probably benign	Het
Ranbp9	T	C	13: 43,406,671	N484S	probably benign	Het
Rassf5	A	G	1: 131,181,249	V293A	probably benign	Het
Ring1	A	G	17: 34,023,446	I29T	probably damaging	Het
Scn1a	G	A	2: 66,324,618	Q666*	probably null	Het
Spice1	G	A	16: 44,379,275	G697R	probably benign	Het
Tas2r131	A	G	6: 132,957,604	F81L	probably benign	Het
Tenm2	G	A	11: 36,163,817	S572L	probably damaging	Het
Tfr2	A	G	5: 137,571,715	T128A	probably benign	Het
Trim56	T	A	5: 137,113,660	Q334L	probably damaging	Het
Vmn2r44	T	A	7: 8,367,528	R840*	probably null	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCATTGCCTAGATTCATGGTC -3'
(R):5'- ATGACTTGGACGCCGTGAAG -3'

Sequencing Primer
(F):5'- GCCTAGATTCATGGTCAGACTCATG -3'
(R):5'- CCGTGAAGCTGGTAGTCAG -3'

Posted On

2019-05-15