Mutagenetix > Incidental Mutation

Incidental Mutation 'R7116:Aox3'

551747

Institutional Source

Beutler Lab

Gene Symbol

Aox3

Ensembl Gene

ENSMUSG00000064294

Gene Name

aldehyde oxidase 3

Synonyms

AOH1, 1200011D03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58113130-58200698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58153530 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 554 (E554D)

Ref Sequence

ENSEMBL: ENSMUSP00000049391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040999]

AlphaFold

G3X982

PDB Structure

Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000040999
AA Change: E554D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: E554D

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.4e-9	PFAM
Pfam:Fer2_2	91	165	1e-29	PFAM
Pfam:FAD_binding_5	239	419	1e-44	PFAM
CO_deh_flav_C	426	530	9.26e-24	SMART
Ald_Xan_dh_C	594	697	2.27e-41	SMART
Pfam:Ald_Xan_dh_C2	708	1241	8.7e-183	PFAM
low complexity region	1275	1286	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Aox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Aox3	APN	1	58169794	missense	probably damaging	1.00
IGL01747:Aox3	APN	1	58159658	missense	probably damaging	0.97
IGL01883:Aox3	APN	1	58138283	missense	probably damaging	1.00
IGL01911:Aox3	APN	1	58152560	missense	probably benign	0.04
IGL02017:Aox3	APN	1	58120992	missense	probably damaging	1.00
IGL02120:Aox3	APN	1	58127650	missense	probably benign	0.00
IGL02466:Aox3	APN	1	58158272	missense	probably benign	0.28
IGL02545:Aox3	APN	1	58183486	missense	probably damaging	1.00
IGL02572:Aox3	APN	1	58158367	missense	probably damaging	1.00
IGL02746:Aox3	APN	1	58183542	missense	possibly damaging	0.83
IGL02808:Aox3	APN	1	58142700	missense	probably damaging	0.99
IGL02812:Aox3	APN	1	58165896	missense	probably benign	0.00
IGL02982:Aox3	APN	1	58127687	missense	probably benign	0.00
IGL03056:Aox3	APN	1	58159021	critical splice donor site	probably null
IGL03182:Aox3	APN	1	58165887	missense	probably benign	0.02
IGL03234:Aox3	APN	1	58152686	missense	probably benign
IGL03374:Aox3	APN	1	58171848	missense	probably damaging	1.00
amber	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0135:Aox3	UTSW	1	58125088	splice site	probably benign
R0332:Aox3	UTSW	1	58142751	missense	probably benign	0.00
R0626:Aox3	UTSW	1	58172299	missense	possibly damaging	0.94
R1325:Aox3	UTSW	1	58176567	nonsense	probably null
R1435:Aox3	UTSW	1	58163446	critical splice donor site	probably null
R1438:Aox3	UTSW	1	58153178	missense	probably benign
R1567:Aox3	UTSW	1	58194693	missense	probably damaging	0.96
R1575:Aox3	UTSW	1	58152554	missense	probably benign	0.04
R1759:Aox3	UTSW	1	58170646	splice site	probably null
R1785:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1786:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1921:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R1984:Aox3	UTSW	1	58153061	missense	possibly damaging	0.88
R2012:Aox3	UTSW	1	58138232	missense	probably benign	0.02
R2080:Aox3	UTSW	1	58186280	missense	probably benign	0.06
R2121:Aox3	UTSW	1	58152549	splice site	probably benign
R2126:Aox3	UTSW	1	58158216	missense	probably benign	0.25
R2130:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2131:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2132:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2133:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2385:Aox3	UTSW	1	58138289	missense	probably damaging	1.00
R2495:Aox3	UTSW	1	58188408	missense	probably damaging	0.99
R4200:Aox3	UTSW	1	58188378	missense	probably damaging	1.00
R4231:Aox3	UTSW	1	58114885	missense	probably benign	0.12
R4591:Aox3	UTSW	1	58152656	missense	probably damaging	0.99
R4627:Aox3	UTSW	1	58125035	missense	probably damaging	0.98
R4831:Aox3	UTSW	1	58152566	missense	probably damaging	0.97
R4864:Aox3	UTSW	1	58176487	missense	probably damaging	1.00
R4976:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5007:Aox3	UTSW	1	58163424	missense	probably benign
R5119:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5175:Aox3	UTSW	1	58172328	missense	probably benign	0.01
R5360:Aox3	UTSW	1	58146508	missense	probably damaging	1.00
R5784:Aox3	UTSW	1	58153499	missense	probably benign	0.00
R6050:Aox3	UTSW	1	58180655	missense	possibly damaging	0.93
R6056:Aox3	UTSW	1	58169859	missense	probably damaging	1.00
R6162:Aox3	UTSW	1	58159731	missense	possibly damaging	0.75
R6181:Aox3	UTSW	1	58158946	missense	probably benign	0.03
R6374:Aox3	UTSW	1	58172161	missense	probably benign	0.11
R6662:Aox3	UTSW	1	58118615	missense	probably damaging	1.00
R6809:Aox3	UTSW	1	58118681	missense	probably damaging	0.99
R6810:Aox3	UTSW	1	58141431	missense	probably benign	0.00
R6821:Aox3	UTSW	1	58150388	missense	probably benign	0.04
R7039:Aox3	UTSW	1	58176555	missense	probably damaging	1.00
R7146:Aox3	UTSW	1	58158529	splice site	probably null
R7163:Aox3	UTSW	1	58119512	missense	probably damaging	0.99
R7243:Aox3	UTSW	1	58138307	missense	unknown
R7319:Aox3	UTSW	1	58152602	missense	probably benign	0.04
R7423:Aox3	UTSW	1	58121069	missense	possibly damaging	0.80
R7664:Aox3	UTSW	1	58119539	missense	probably damaging	1.00
R7709:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R7745:Aox3	UTSW	1	58176517	missense	possibly damaging	0.75
R7751:Aox3	UTSW	1	58179335	missense	probably benign	0.11
R7912:Aox3	UTSW	1	58142696	missense	probably benign	0.05
R7940:Aox3	UTSW	1	58188437	missense	probably damaging	1.00
R8143:Aox3	UTSW	1	58158915	missense	probably benign	0.05
R8178:Aox3	UTSW	1	58150322	missense	possibly damaging	0.64
R8719:Aox3	UTSW	1	58119537	missense	probably damaging	1.00
R8861:Aox3	UTSW	1	58150301	missense	probably benign
R9379:Aox3	UTSW	1	58169800	missense	possibly damaging	0.77
R9459:Aox3	UTSW	1	58150309	missense	probably benign	0.10
R9472:Aox3	UTSW	1	58176510	missense	possibly damaging	0.47
R9479:Aox3	UTSW	1	58138409	missense	probably benign	0.23
R9521:Aox3	UTSW	1	58125063	missense	probably benign	0.10
R9750:Aox3	UTSW	1	58176489	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAACCCAAAGCTCTCAAGTTTG -3'
(R):5'- ATTGGGTGCATGATGTGAAATCC -3'

Sequencing Primer
(F):5'- GTTTGCTCAAACTTTCCCAAAGC -3'
(R):5'- GACAGATGCAGCCTCTTT -3'

Posted On

2019-05-15