Mutagenetix > Incidental Mutations

Incidental Mutation 'R7116:Nfatc2'

551753

Institutional Source

Beutler Lab

Gene Symbol

Nfatc2

Ensembl Gene

ENSMUSG00000027544

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2

Synonyms

NFAT1-D, NFATp, NFAT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

168476410-168601657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 168507349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 626 (M626K)

Ref Sequence

ENSEMBL: ENSMUSP00000074198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074618] [ENSMUST00000109184]

AlphaFold

Q60591

Predicted Effect

probably benign
Transcript: ENSMUST00000074618
AA Change: M626K

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: M626K

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD_DNA_bind	412	572	2.8e-24	PFAM
IPT	579	678	1.65e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109184
AA Change: M626K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: M626K

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD	412	572	1.3e-24	PFAM
IPT	579	678	1.65e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Nfatc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Nfatc2	APN	2	168504890	missense	probably damaging	1.00
IGL01728:Nfatc2	APN	2	168536242	missense	probably damaging	1.00
IGL02303:Nfatc2	APN	2	168506901	nonsense	probably null
IGL02887:Nfatc2	APN	2	168504450	missense	probably damaging	1.00
IGL03002:Nfatc2	APN	2	168534984	missense	probably damaging	1.00
IGL03297:Nfatc2	APN	2	168536218	missense	probably damaging	0.99
R0347:Nfatc2	UTSW	2	168536290	missense	probably damaging	1.00
R0590:Nfatc2	UTSW	2	168571199	missense	probably damaging	0.99
R0631:Nfatc2	UTSW	2	168590115	missense	probably benign	0.02
R1019:Nfatc2	UTSW	2	168504879	missense	probably damaging	1.00
R1183:Nfatc2	UTSW	2	168590088	missense	possibly damaging	0.83
R1420:Nfatc2	UTSW	2	168504665	missense	probably benign	0.01
R1977:Nfatc2	UTSW	2	168504459	missense	possibly damaging	0.68
R2306:Nfatc2	UTSW	2	168590103	missense	probably damaging	1.00
R3034:Nfatc2	UTSW	2	168535020	missense	probably damaging	1.00
R3176:Nfatc2	UTSW	2	168506994	missense	possibly damaging	0.51
R3276:Nfatc2	UTSW	2	168506994	missense	possibly damaging	0.51
R3964:Nfatc2	UTSW	2	168504549	missense	probably benign	0.00
R3966:Nfatc2	UTSW	2	168504549	missense	probably benign	0.00
R4669:Nfatc2	UTSW	2	168571490	missense	probably benign
R4864:Nfatc2	UTSW	2	168536392	missense	probably damaging	0.96
R4951:Nfatc2	UTSW	2	168571072	missense	probably damaging	0.98
R5138:Nfatc2	UTSW	2	168536309	missense	probably damaging	1.00
R5145:Nfatc2	UTSW	2	168590067	missense	probably benign	0.25
R5185:Nfatc2	UTSW	2	168570707	missense	possibly damaging	0.48
R5444:Nfatc2	UTSW	2	168534890	intron	probably benign
R5496:Nfatc2	UTSW	2	168536278	missense	probably damaging	1.00
R5728:Nfatc2	UTSW	2	168480249	missense	probably benign
R5791:Nfatc2	UTSW	2	168536393	missense	probably benign	0.28
R6102:Nfatc2	UTSW	2	168519507	intron	probably benign
R6157:Nfatc2	UTSW	2	168519451	intron	probably benign
R6187:Nfatc2	UTSW	2	168480238	missense	probably benign	0.13
R7218:Nfatc2	UTSW	2	168571264	missense	probably benign	0.01
R7470:Nfatc2	UTSW	2	168523307	nonsense	probably null
R7594:Nfatc2	UTSW	2	168523348	missense	probably damaging	1.00
R7618:Nfatc2	UTSW	2	168534999	missense	probably damaging	1.00
R7653:Nfatc2	UTSW	2	168571145	missense	probably benign	0.01
R8425:Nfatc2	UTSW	2	168536296	missense	probably damaging	1.00
R8485:Nfatc2	UTSW	2	168590092	missense	probably damaging	1.00
R8791:Nfatc2	UTSW	2	168536294	missense	probably damaging	0.99
R9024:Nfatc2	UTSW	2	168486728	makesense	probably null
Z1176:Nfatc2	UTSW	2	168571349	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACCCAGATCCTGAGTGTGTC -3'
(R):5'- ACCCATCACACATATACACATGC -3'

Sequencing Primer
(F):5'- GTGCCCTACATCTGACTGAAAGG -3'
(R):5'- TATACACATGCATACTCACACACATG -3'

Posted On

2019-05-15