Incidental Mutation 'R7116:Vmn2r37'
ID 551766
Institutional Source Beutler Lab
Gene Symbol Vmn2r37
Ensembl Gene ENSMUSG00000066828
Gene Name vomeronasal 2, receptor 37
Synonyms V2r14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7116 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 9205546-9223653 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9217899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 322 (T322A)
Ref Sequence ENSEMBL: ENSMUSP00000072566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072787]
AlphaFold F8VQD3
Predicted Effect probably benign
Transcript: ENSMUST00000072787
AA Change: T322A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072566
Gene: ENSMUSG00000066828
AA Change: T322A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 157 469 2.9e-26 PFAM
Pfam:NCD3G 512 563 1.1e-16 PFAM
Pfam:7tm_3 550 783 1.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Akap13 T A 7: 75,720,195 S129T probably benign Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Vmn2r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vmn2r37 APN 7 9206681 missense probably benign 0.05
IGL01909:Vmn2r37 APN 7 9216033 nonsense probably null
IGL02281:Vmn2r37 APN 7 9217882 missense possibly damaging 0.95
IGL02282:Vmn2r37 APN 7 9206762 missense probably benign 0.19
IGL02513:Vmn2r37 APN 7 9217935 missense probably benign 0.14
R0136:Vmn2r37 UTSW 7 9217783 nonsense probably null
R2051:Vmn2r37 UTSW 7 9217793 missense probably damaging 1.00
R2262:Vmn2r37 UTSW 7 9217944 missense probably damaging 0.99
R3158:Vmn2r37 UTSW 7 9217714 missense probably benign 0.03
R4084:Vmn2r37 UTSW 7 9215985 missense probably benign
R4114:Vmn2r37 UTSW 7 9210093 critical splice acceptor site probably null
R5231:Vmn2r37 UTSW 7 9206595 missense possibly damaging 0.94
R5462:Vmn2r37 UTSW 7 9217974 missense probably damaging 1.00
R6437:Vmn2r37 UTSW 7 9217851 missense probably damaging 0.98
R7104:Vmn2r37 UTSW 7 9216046 missense probably damaging 1.00
R7381:Vmn2r37 UTSW 7 9210033 missense probably benign 0.21
R8775:Vmn2r37 UTSW 7 9215992 nonsense probably null
R8775-TAIL:Vmn2r37 UTSW 7 9215992 nonsense probably null
R8869:Vmn2r37 UTSW 7 9206855 missense possibly damaging 0.50
R8884:Vmn2r37 UTSW 7 9215917 missense probably benign
RF004:Vmn2r37 UTSW 7 9217687 missense probably damaging 0.97
Z1177:Vmn2r37 UTSW 7 9209997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCCATTAGCCAATCAAATGAG -3'
(R):5'- GCTTTGCCTTTGTGAAAATGATCTC -3'

Sequencing Primer
(F):5'- TAGCCAATCAAATGAGGCATTAGATG -3'
(R):5'- ACCAAATTGTGATGTCATCCAC -3'
Posted On 2019-05-15