Mutagenetix > Incidental Mutation

Incidental Mutation 'R7116:Ltbp4'

551767

Institutional Source

Beutler Lab

Gene Symbol

Ltbp4

Ensembl Gene

ENSMUSG00000040488

Gene Name

latent transforming growth factor beta binding protein 4

Synonyms

2310046A13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27305136-27337692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27305427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1657 (H1657L)

Ref Sequence

ENSEMBL: ENSMUSP00000037536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000121175] [ENSMUST00000125455]

AlphaFold

Q8K4G1

Predicted Effect

probably damaging
Transcript: ENSMUST00000038618
AA Change: H1657L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: H1657L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	112	125	N/A	INTRINSIC
EGF	151	180	2.74e-3	SMART
low complexity region	244	265	N/A	INTRINSIC
EGF_CA	356	396	3.51e-10	SMART
Pfam:TB	416	457	4.8e-15	PFAM
low complexity region	490	501	N/A	INTRINSIC
low complexity region	507	568	N/A	INTRINSIC
low complexity region	579	590	N/A	INTRINSIC
EGF	591	629	6.06e-5	SMART
EGF_CA	630	671	8.3e-12	SMART
EGF_CA	672	713	7.34e-13	SMART
EGF_CA	714	751	8.43e-13	SMART
EGF_CA	753	794	1.66e-11	SMART
EGF_CA	795	836	3.61e-12	SMART
EGF_CA	837	876	5.61e-9	SMART
EGF_CA	877	919	1.73e-9	SMART
EGF_CA	920	961	7.12e-11	SMART
EGF_CA	962	1002	3.56e-11	SMART
EGF_CA	1003	1046	1.61e-9	SMART
EGF_CA	1047	1090	2.13e-9	SMART
EGF_CA	1091	1132	1.02e-11	SMART
EGF	1136	1175	1.69e1	SMART
low complexity region	1185	1223	N/A	INTRINSIC
Pfam:TB	1234	1276	1.7e-13	PFAM
EGF_CA	1295	1337	2.72e-7	SMART
EGF_CA	1338	1379	1.36e-7	SMART
Pfam:TB	1402	1443	4.3e-14	PFAM
low complexity region	1449	1461	N/A	INTRINSIC
low complexity region	1478	1500	N/A	INTRINSIC
EGF	1578	1615	6.06e-5	SMART
EGF_CA	1616	1660	9.54e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108369
AA Change: H1656L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: H1656L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	116	145	N/A	INTRINSIC
EGF	150	179	2.74e-3	SMART
low complexity region	243	264	N/A	INTRINSIC
EGF_CA	355	395	3.51e-10	SMART
Pfam:TB	414	456	2.5e-14	PFAM
low complexity region	489	500	N/A	INTRINSIC
low complexity region	506	567	N/A	INTRINSIC
low complexity region	578	589	N/A	INTRINSIC
EGF	590	628	6.06e-5	SMART
EGF_CA	629	670	8.3e-12	SMART
EGF_CA	671	712	7.34e-13	SMART
EGF_CA	713	750	8.43e-13	SMART
EGF_CA	752	793	1.66e-11	SMART
EGF_CA	794	835	3.61e-12	SMART
EGF_CA	836	875	5.61e-9	SMART
EGF_CA	876	918	1.73e-9	SMART
EGF_CA	919	960	7.12e-11	SMART
EGF_CA	961	1001	3.56e-11	SMART
EGF_CA	1002	1045	1.61e-9	SMART
EGF_CA	1046	1089	2.13e-9	SMART
EGF_CA	1090	1131	1.02e-11	SMART
EGF	1135	1174	1.69e1	SMART
low complexity region	1184	1222	N/A	INTRINSIC
Pfam:TB	1232	1275	2.4e-13	PFAM
EGF_CA	1294	1336	2.72e-7	SMART
EGF_CA	1337	1378	1.36e-7	SMART
Pfam:TB	1400	1442	7.6e-15	PFAM
low complexity region	1448	1460	N/A	INTRINSIC
low complexity region	1477	1499	N/A	INTRINSIC
EGF	1577	1614	6.06e-5	SMART
EGF_CA	1615	1659	9.54e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118583

SMART Domains

Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	2.3e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART
low complexity region	1119	1157	N/A	INTRINSIC
Pfam:TB	1167	1210	2.2e-13	PFAM
EGF_CA	1229	1271	2.72e-7	SMART
EGF_CA	1272	1313	1.36e-7	SMART
Pfam:TB	1335	1377	7.1e-15	PFAM
low complexity region	1383	1395	N/A	INTRINSIC
low complexity region	1412	1434	N/A	INTRINSIC
EGF	1512	1549	6.06e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121175
AA Change: H1591L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: H1591L

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	3.4e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART
low complexity region	1119	1157	N/A	INTRINSIC
Pfam:TB	1167	1210	3.3e-13	PFAM
EGF_CA	1229	1271	2.72e-7	SMART
EGF_CA	1272	1313	1.36e-7	SMART
Pfam:TB	1335	1377	1e-14	PFAM
low complexity region	1383	1395	N/A	INTRINSIC
low complexity region	1412	1434	N/A	INTRINSIC
EGF	1512	1549	6.06e-5	SMART
EGF_CA	1550	1594	9.54e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125455

SMART Domains

Protein: ENSMUSP00000120326
Gene: ENSMUSG00000040488

Domain	Start	End	E-Value	Type
Pfam:TB	9	52	1.9e-14	PFAM
Pfam:TB	85	127	6e-16	PFAM
low complexity region	133	145	N/A	INTRINSIC
low complexity region	162	184	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Ltbp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Ltbp4	APN	7	27328805	missense	probably damaging	0.96
IGL00585:Ltbp4	APN	7	27326733	missense	probably damaging	0.98
IGL01320:Ltbp4	APN	7	27328359	splice site	probably benign
IGL01860:Ltbp4	APN	7	27319646	missense	probably damaging	1.00
IGL02026:Ltbp4	APN	7	27327417	nonsense	probably null
IGL02226:Ltbp4	APN	7	27306934	missense	probably damaging	1.00
IGL02422:Ltbp4	APN	7	27319672	missense	probably damaging	1.00
IGL02611:Ltbp4	APN	7	27310655	missense	probably damaging	1.00
IGL02892:Ltbp4	APN	7	27310649	missense	probably damaging	1.00
IGL02926:Ltbp4	APN	7	27328872	splice site	probably null
IGL02950:Ltbp4	APN	7	27306718	missense	probably damaging	0.99
IGL03008:Ltbp4	APN	7	27324364	missense	probably damaging	0.99
IGL03271:Ltbp4	APN	7	27329815	missense	unknown
IGL02837:Ltbp4	UTSW	7	27314381	missense	probably damaging	1.00
R0792:Ltbp4	UTSW	7	27325060	missense	probably damaging	1.00
R0980:Ltbp4	UTSW	7	27324162	missense	probably damaging	1.00
R1017:Ltbp4	UTSW	7	27306076	missense	possibly damaging	0.95
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1403:Ltbp4	UTSW	7	27329039	missense	unknown
R1403:Ltbp4	UTSW	7	27329039	missense	unknown
R1448:Ltbp4	UTSW	7	27306577	missense	possibly damaging	0.86
R1575:Ltbp4	UTSW	7	27322820	missense	probably damaging	1.00
R1918:Ltbp4	UTSW	7	27337569	unclassified	probably benign
R1932:Ltbp4	UTSW	7	27307766	critical splice donor site	probably null
R1959:Ltbp4	UTSW	7	27329018	missense	unknown
R1960:Ltbp4	UTSW	7	27329018	missense	unknown
R1976:Ltbp4	UTSW	7	27326770	missense	probably damaging	1.00
R2060:Ltbp4	UTSW	7	27308953	missense	probably damaging	1.00
R2333:Ltbp4	UTSW	7	27327778	missense	possibly damaging	0.82
R2431:Ltbp4	UTSW	7	27319676	missense	possibly damaging	0.91
R3125:Ltbp4	UTSW	7	27327778	missense	possibly damaging	0.82
R4093:Ltbp4	UTSW	7	27325216	missense	possibly damaging	0.93
R4095:Ltbp4	UTSW	7	27325216	missense	possibly damaging	0.93
R4592:Ltbp4	UTSW	7	27325183	missense	probably damaging	0.96
R4610:Ltbp4	UTSW	7	27306700	missense	probably damaging	1.00
R4650:Ltbp4	UTSW	7	27314309	missense	probably damaging	1.00
R4912:Ltbp4	UTSW	7	27306116	nonsense	probably null
R5002:Ltbp4	UTSW	7	27327685	frame shift	probably null
R5016:Ltbp4	UTSW	7	27327685	frame shift	probably null
R5216:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5218:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5219:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5219:Ltbp4	UTSW	7	27327321	missense	probably benign	0.01
R5539:Ltbp4	UTSW	7	27327724	missense	probably damaging	0.97
R5991:Ltbp4	UTSW	7	27309316	missense	probably damaging	1.00
R6082:Ltbp4	UTSW	7	27335680	unclassified	probably benign
R6125:Ltbp4	UTSW	7	27327755	missense	probably damaging	1.00
R6146:Ltbp4	UTSW	7	27319724	missense	probably damaging	0.99
R6156:Ltbp4	UTSW	7	27330162	missense	unknown
R6414:Ltbp4	UTSW	7	27310715	missense	probably damaging	1.00
R6563:Ltbp4	UTSW	7	27309063	missense	probably damaging	1.00
R6719:Ltbp4	UTSW	7	27328763	missense	probably damaging	0.99
R6940:Ltbp4	UTSW	7	27308944	missense	probably damaging	1.00
R7054:Ltbp4	UTSW	7	27307766	critical splice donor site	probably null
R7326:Ltbp4	UTSW	7	27329755	missense	unknown
R7419:Ltbp4	UTSW	7	27329767	missense	unknown
R8068:Ltbp4	UTSW	7	27324168	missense	probably damaging	0.99
R8435:Ltbp4	UTSW	7	27335445	missense	unknown
R8543:Ltbp4	UTSW	7	27325241	missense	possibly damaging	0.84
R8897:Ltbp4	UTSW	7	27326694	missense	probably benign	0.09
R9103:Ltbp4	UTSW	7	27328761	missense	unknown
R9131:Ltbp4	UTSW	7	27337551	missense	unknown
R9206:Ltbp4	UTSW	7	27322925	missense	probably damaging	1.00
R9301:Ltbp4	UTSW	7	27322153	missense	probably damaging	0.98
R9302:Ltbp4	UTSW	7	27309056	missense	possibly damaging	0.80
X0025:Ltbp4	UTSW	7	27325802	missense	probably damaging	1.00
X0066:Ltbp4	UTSW	7	27306065	critical splice donor site	probably null
Z1088:Ltbp4	UTSW	7	27307792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGAGCCAGCTTTTGAG -3'
(R):5'- TGGCCTGATTCCTGGACATG -3'

Sequencing Primer
(F):5'- CATGACAGGCTGGCACCATAG -3'
(R):5'- GCCTGATTCCTGGACATGAGTAAC -3'

Posted On

2019-05-15