Incidental Mutation 'R7116:Akap13'
ID 551772
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase (PRKA) anchor protein 13
Synonyms AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7116 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 75455534-75754609 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75720195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 129 (S129T)
Ref Sequence ENSEMBL: ENSMUSP00000146401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166315
AA Change: S1830T

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: S1830T

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207239
AA Change: S129T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: S1848T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,204,977 S109P probably damaging Het
Afg3l1 T G 8: 123,489,862 L280R probably damaging Het
Ankrd11 A G 8: 122,896,130 S328P probably damaging Het
Aox3 A T 1: 58,153,530 E554D probably benign Het
Bcl11a T C 11: 24,163,839 V394A probably damaging Het
Cass4 A G 2: 172,427,969 Y657C unknown Het
Ccdc88a C T 11: 29,504,051 A1738V probably benign Het
Cfap74 T C 4: 155,455,061 F948L unknown Het
Chgb A T 2: 132,781,317 probably benign Het
Coro1c C T 5: 113,852,206 W138* probably null Het
Dgkb A G 12: 37,981,990 Q17R probably benign Het
Esco2 A G 14: 65,826,557 Y393H probably damaging Het
Eya3 T A 4: 132,694,799 D228E probably benign Het
Fat2 T C 11: 55,282,336 D2517G probably damaging Het
Fry T A 5: 150,395,869 probably null Het
Gal3st2b A T 1: 93,940,776 Q243L possibly damaging Het
Gimap9 C T 6: 48,678,055 A192V probably benign Het
Glg1 T A 8: 111,178,957 Q564L probably benign Het
H2-Aa A T 17: 34,283,627 Y188* probably null Het
Hira T C 16: 18,912,114 Y188H probably damaging Het
Ighv8-8 C T 12: 115,294,194 D76N probably benign Het
Irf6 T C 1: 193,167,597 F276L probably damaging Het
Itpr1 T C 6: 108,481,268 C2000R probably damaging Het
Jakmip3 T C 7: 139,020,250 V293A possibly damaging Het
Kcnh7 A G 2: 62,877,270 V132A probably benign Het
Kcnj1 A G 9: 32,396,981 T234A possibly damaging Het
Kpna3 T A 14: 61,368,186 N470I probably benign Het
Lamb2 T C 9: 108,487,323 F1121L probably damaging Het
Lingo1 T C 9: 56,620,627 D232G probably benign Het
Lpxn T A 19: 12,811,258 N70K probably benign Het
Ltbp4 T A 7: 27,305,427 H1657L probably damaging Het
Luzp2 C A 7: 55,265,330 F334L possibly damaging Het
Mgat5b A T 11: 116,944,959 S142C possibly damaging Het
Mroh7 G A 4: 106,711,320 T396I probably benign Het
Muc5b T C 7: 141,863,750 S3478P probably benign Het
Nfatc2 A T 2: 168,507,349 M626K probably benign Het
Nlrp14 A G 7: 107,183,048 D484G possibly damaging Het
Npc1 T C 18: 12,211,544 Y423C probably damaging Het
Nrsn1 A G 13: 25,253,405 I180T probably damaging Het
Olfr570 T A 7: 102,900,635 N89K probably benign Het
Olfr741 A T 14: 50,485,568 I37F probably benign Het
Osbpl6 A T 2: 76,595,881 I935F probably benign Het
Otog T C 7: 46,298,265 F96L probably damaging Het
Pde1b T C 15: 103,528,318 L534P possibly damaging Het
Pdzd8 C T 19: 59,299,693 E1092K probably damaging Het
Pfkl T C 10: 78,001,415 H108R probably benign Het
Pkhd1l1 G A 15: 44,557,976 V3047I probably benign Het
Plag1 A T 4: 3,904,812 C126* probably null Het
Pphln1 T A 15: 93,455,525 S229T probably benign Het
Pramel5 C T 4: 144,273,881 D42N possibly damaging Het
Psd3 A G 8: 67,713,738 V915A probably benign Het
Ptdss1 T A 13: 66,945,327 I77N probably benign Het
Rsbn1 T A 3: 103,914,576 C3* probably null Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Sv2c A T 13: 95,976,644 V599E probably damaging Het
Vmn2r37 T C 7: 9,217,899 T322A probably benign Het
Vmn2r60 T A 7: 42,137,063 M430K probably benign Het
Wipf3 T A 6: 54,481,919 probably null Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7834:Akap13 UTSW 7 75742642 missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75586216 missense probably damaging 0.97
R7942:Akap13 UTSW 7 75611470 missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75579696 missense probably damaging 1.00
R8009:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8011:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8012:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8013:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8016:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8089:Akap13 UTSW 7 75610592 missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75702231 splice site probably null
R8174:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75747804 missense probably damaging 1.00
R8444:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8445:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8465:Akap13 UTSW 7 75727038 missense probably benign 0.11
R8512:Akap13 UTSW 7 75611086 missense probably damaging 0.99
R8523:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8793:Akap13 UTSW 7 75725328 missense probably benign 0.35
R8907:Akap13 UTSW 7 75610696 missense probably benign 0.08
R8907:Akap13 UTSW 7 75610708 missense probably damaging 0.99
R8928:Akap13 UTSW 7 75609858 missense probably benign 0.00
R8929:Akap13 UTSW 7 75609004 missense probably benign 0.00
R8937:Akap13 UTSW 7 75534853 critical splice donor site probably null
R8967:Akap13 UTSW 7 75729134 missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75609326 missense probably benign
R9152:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R9153:Akap13 UTSW 7 75609481 missense probably benign 0.00
R9160:Akap13 UTSW 7 75735778 missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75704501 missense probably benign 0.06
R9319:Akap13 UTSW 7 75609088 missense probably benign 0.01
R9513:Akap13 UTSW 7 75704527 missense probably benign 0.01
R9515:Akap13 UTSW 7 75704527 missense probably benign 0.01
R9516:Akap13 UTSW 7 75704527 missense probably benign 0.01
R9523:Akap13 UTSW 7 75643445 missense
R9564:Akap13 UTSW 7 75609413 missense probably benign
R9621:Akap13 UTSW 7 75736342 missense probably benign 0.09
R9686:Akap13 UTSW 7 75586336 missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75730552 missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75615005 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCTAGCCGCTTATCTGCAG -3'
(R):5'- TTGGTCATTAAATGTGGCAGAAGC -3'

Sequencing Primer
(F):5'- CTCTTGGTGAGCGCAAAGG -3'
(R):5'- AAGCTAGTGGCCTAGTGCATTAC -3'
Posted On 2019-05-15