Mutagenetix > Incidental Mutation

Incidental Mutation 'R7116:Ankrd11'

551779

Institutional Source

Beutler Lab

Gene Symbol

Ankrd11

Ensembl Gene

ENSMUSG00000035569

Gene Name

ankyrin repeat domain 11

Synonyms

3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122883822-123042277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122896130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 328 (S328P)

Ref Sequence

ENSEMBL: ENSMUSP00000095938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]

AlphaFold

E9Q4F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000098333
AA Change: S328P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: S328P

Domain	Start	End	E-Value	Type
ANK	188	217	2.58e-3	SMART
ANK	221	250	1.31e-4	SMART
ANK	254	283	5.04e-6	SMART
low complexity region	311	324	N/A	INTRINSIC
low complexity region	366	377	N/A	INTRINSIC
low complexity region	429	440	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	499	521	N/A	INTRINSIC
low complexity region	534	549	N/A	INTRINSIC
low complexity region	596	609	N/A	INTRINSIC
low complexity region	649	669	N/A	INTRINSIC
coiled coil region	786	826	N/A	INTRINSIC
low complexity region	867	877	N/A	INTRINSIC
low complexity region	965	984	N/A	INTRINSIC
low complexity region	1040	1055	N/A	INTRINSIC
low complexity region	1058	1082	N/A	INTRINSIC
low complexity region	1187	1200	N/A	INTRINSIC
low complexity region	1204	1227	N/A	INTRINSIC
low complexity region	1268	1289	N/A	INTRINSIC
low complexity region	1294	1306	N/A	INTRINSIC
coiled coil region	1374	1406	N/A	INTRINSIC
low complexity region	1476	1496	N/A	INTRINSIC
low complexity region	1508	1523	N/A	INTRINSIC
low complexity region	1526	1547	N/A	INTRINSIC
coiled coil region	1598	1625	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1874	1885	N/A	INTRINSIC
low complexity region	1913	1922	N/A	INTRINSIC
low complexity region	1969	1979	N/A	INTRINSIC
low complexity region	2035	2045	N/A	INTRINSIC
low complexity region	2057	2071	N/A	INTRINSIC
low complexity region	2162	2179	N/A	INTRINSIC
low complexity region	2191	2209	N/A	INTRINSIC
low complexity region	2224	2236	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC
low complexity region	2294	2305	N/A	INTRINSIC
low complexity region	2391	2409	N/A	INTRINSIC
low complexity region	2445	2455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098334
AA Change: S307P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: S307P

Domain	Start	End	E-Value	Type
ANK	167	196	2.58e-3	SMART
ANK	200	229	1.31e-4	SMART
ANK	233	262	5.04e-6	SMART
low complexity region	290	303	N/A	INTRINSIC
low complexity region	345	356	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
low complexity region	449	466	N/A	INTRINSIC
low complexity region	478	500	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	575	588	N/A	INTRINSIC
low complexity region	628	648	N/A	INTRINSIC
coiled coil region	765	805	N/A	INTRINSIC
low complexity region	846	856	N/A	INTRINSIC
low complexity region	944	963	N/A	INTRINSIC
low complexity region	1019	1034	N/A	INTRINSIC
low complexity region	1037	1061	N/A	INTRINSIC
low complexity region	1166	1179	N/A	INTRINSIC
low complexity region	1183	1206	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1273	1285	N/A	INTRINSIC
coiled coil region	1353	1385	N/A	INTRINSIC
low complexity region	1455	1475	N/A	INTRINSIC
low complexity region	1487	1502	N/A	INTRINSIC
low complexity region	1505	1526	N/A	INTRINSIC
coiled coil region	1577	1604	N/A	INTRINSIC
low complexity region	1749	1760	N/A	INTRINSIC
low complexity region	1853	1864	N/A	INTRINSIC
low complexity region	1892	1901	N/A	INTRINSIC
low complexity region	1948	1958	N/A	INTRINSIC
low complexity region	2014	2024	N/A	INTRINSIC
low complexity region	2036	2050	N/A	INTRINSIC
low complexity region	2141	2158	N/A	INTRINSIC
low complexity region	2170	2188	N/A	INTRINSIC
low complexity region	2203	2215	N/A	INTRINSIC
low complexity region	2229	2242	N/A	INTRINSIC
low complexity region	2273	2284	N/A	INTRINSIC
low complexity region	2370	2388	N/A	INTRINSIC
low complexity region	2424	2434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172906

Predicted Effect

probably benign
Transcript: ENSMUST00000212050

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Ankrd11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ankrd11	APN	8	122908728	missense	possibly damaging	0.59
IGL00971:Ankrd11	APN	8	122895353	missense	probably damaging	1.00
IGL01017:Ankrd11	APN	8	122894728	missense	probably damaging	1.00
IGL01137:Ankrd11	APN	8	122884336	missense	probably damaging	0.99
IGL01659:Ankrd11	APN	8	122895371	missense	probably damaging	1.00
IGL01920:Ankrd11	APN	8	122915897	splice site	probably benign
IGL01964:Ankrd11	APN	8	122889736	missense	probably damaging	0.97
IGL02131:Ankrd11	APN	8	122894410	missense	probably damaging	1.00
IGL02226:Ankrd11	APN	8	122892245	missense	probably damaging	1.00
IGL02549:Ankrd11	APN	8	122891293	missense	probably damaging	1.00
IGL02642:Ankrd11	APN	8	122890651	missense	probably damaging	1.00
IGL02643:Ankrd11	APN	8	122892322	missense	probably damaging	0.98
IGL02861:Ankrd11	APN	8	122895827	missense	probably damaging	0.99
IGL03086:Ankrd11	APN	8	122894510	missense	probably damaging	1.00
IGL03336:Ankrd11	APN	8	122891843	missense	probably benign	0.00
anchors	UTSW	8	122895770	missense	probably damaging	0.99
away	UTSW	8	122891953	missense	probably damaging	1.00
bluebell	UTSW	8	122891785	missense	probably damaging	0.97
Navy	UTSW	8	122908734	nonsense	probably null
BB001:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
BB011:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0110:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0281:Ankrd11	UTSW	8	122895568	missense	probably benign	0.01
R0450:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0481:Ankrd11	UTSW	8	122900036	missense	probably damaging	1.00
R0542:Ankrd11	UTSW	8	122895770	missense	probably damaging	0.99
R0606:Ankrd11	UTSW	8	122892832	missense	probably benign	0.04
R0702:Ankrd11	UTSW	8	122889766	missense	probably damaging	1.00
R0730:Ankrd11	UTSW	8	122891953	missense	probably damaging	1.00
R0737:Ankrd11	UTSW	8	122895836	missense	probably damaging	0.99
R1401:Ankrd11	UTSW	8	122893050	missense	probably benign	0.23
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1641:Ankrd11	UTSW	8	122891746	missense	probably benign	0.03
R1950:Ankrd11	UTSW	8	122889869	missense	probably damaging	1.00
R2004:Ankrd11	UTSW	8	122902422	critical splice donor site	probably null
R2401:Ankrd11	UTSW	8	122908734	nonsense	probably null
R2425:Ankrd11	UTSW	8	122893163	missense	possibly damaging	0.86
R2830:Ankrd11	UTSW	8	122892196	missense	probably damaging	1.00
R2910:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R2911:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R3736:Ankrd11	UTSW	8	122891785	missense	probably damaging	0.97
R3738:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3739:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3813:Ankrd11	UTSW	8	122891378	missense	probably benign
R4012:Ankrd11	UTSW	8	122892417	missense	probably damaging	0.98
R4183:Ankrd11	UTSW	8	122899676	missense	possibly damaging	0.88
R4213:Ankrd11	UTSW	8	122891026	missense	probably benign	0.00
R4469:Ankrd11	UTSW	8	122896587	missense	probably damaging	1.00
R4482:Ankrd11	UTSW	8	122893489	missense	probably damaging	1.00
R4935:Ankrd11	UTSW	8	122900183	missense	probably benign	0.02
R4940:Ankrd11	UTSW	8	122889821	missense	probably damaging	1.00
R5145:Ankrd11	UTSW	8	122891204	utr 3 prime	probably benign
R5154:Ankrd11	UTSW	8	122893139	missense	probably damaging	1.00
R5230:Ankrd11	UTSW	8	122890477	missense	probably benign	0.11
R5283:Ankrd11	UTSW	8	122884182	missense	probably damaging	1.00
R5377:Ankrd11	UTSW	8	122893714	splice site	probably null
R5513:Ankrd11	UTSW	8	122892520	missense	probably benign	0.38
R5518:Ankrd11	UTSW	8	122890994	missense	possibly damaging	0.93
R5549:Ankrd11	UTSW	8	122890378	missense	probably benign	0.02
R5579:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R5595:Ankrd11	UTSW	8	122894304	nonsense	probably null
R5650:Ankrd11	UTSW	8	122887397	missense	probably damaging	0.99
R5717:Ankrd11	UTSW	8	122892638	missense	possibly damaging	0.92
R5753:Ankrd11	UTSW	8	122895304	missense	possibly damaging	0.90
R5782:Ankrd11	UTSW	8	122900017	missense	probably damaging	1.00
R5812:Ankrd11	UTSW	8	122893805	splice site	probably null
R5823:Ankrd11	UTSW	8	122895790	missense	probably benign	0.12
R5900:Ankrd11	UTSW	8	122891066	missense	probably benign	0.00
R5975:Ankrd11	UTSW	8	122889749	missense	possibly damaging	0.93
R5979:Ankrd11	UTSW	8	122892400	missense	probably damaging	1.00
R6000:Ankrd11	UTSW	8	122891195	missense	possibly damaging	0.73
R6145:Ankrd11	UTSW	8	122892661	missense	probably damaging	1.00
R6252:Ankrd11	UTSW	8	122893822	missense	possibly damaging	0.87
R6302:Ankrd11	UTSW	8	122889989	missense	probably benign
R6457:Ankrd11	UTSW	8	122908764	missense	probably damaging	1.00
R6513:Ankrd11	UTSW	8	122890180	missense	probably benign	0.02
R6582:Ankrd11	UTSW	8	122891629	missense	probably benign	0.00
R6738:Ankrd11	UTSW	8	122891921	missense	probably damaging	0.99
R6865:Ankrd11	UTSW	8	122894944	missense	probably benign	0.41
R6913:Ankrd11	UTSW	8	122894911	missense	probably benign	0.01
R7101:Ankrd11	UTSW	8	122895455	missense	probably benign	0.35
R7477:Ankrd11	UTSW	8	122894385	missense	possibly damaging	0.91
R7534:Ankrd11	UTSW	8	122894410	missense	probably damaging	1.00
R7555:Ankrd11	UTSW	8	122887406	missense	probably damaging	0.99
R7627:Ankrd11	UTSW	8	122890951	missense	possibly damaging	0.63
R7658:Ankrd11	UTSW	8	122893664	missense	probably benign
R7721:Ankrd11	UTSW	8	122894759	missense	probably damaging	1.00
R7731:Ankrd11	UTSW	8	122895433	missense	probably benign	0.12
R7792:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R7924:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R7939:Ankrd11	UTSW	8	122891073	missense	probably damaging	1.00
R8022:Ankrd11	UTSW	8	122887593	missense	probably damaging	1.00
R8222:Ankrd11	UTSW	8	122895608	missense	probably damaging	0.98
R8362:Ankrd11	UTSW	8	122892058	missense	probably damaging	0.96
R8430:Ankrd11	UTSW	8	122893366	missense	probably benign	0.01
R8511:Ankrd11	UTSW	8	122899729	missense
R8726:Ankrd11	UTSW	8	122894026	missense	possibly damaging	0.90
R8888:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8895:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8928:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8930:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8931:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8936:Ankrd11	UTSW	8	122895101	missense	possibly damaging	0.69
R9018:Ankrd11	UTSW	8	122895512	missense	probably damaging	1.00
R9113:Ankrd11	UTSW	8	122887333	missense	possibly damaging	0.60
R9399:Ankrd11	UTSW	8	122891440	missense	probably benign
R9644:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9645:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9647:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9683:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
RF019:Ankrd11	UTSW	8	122896634	missense	probably damaging	1.00
Z1176:Ankrd11	UTSW	8	122895803	missense	possibly damaging	0.68
Z1177:Ankrd11	UTSW	8	122900142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAAATGAAGCTGTTGGCC -3'
(R):5'- TGACTAAGTCAAGTGCTTCTTCAG -3'

Sequencing Primer
(F):5'- AAATGAAGCTGTTGGCCTTAGC -3'
(R):5'- TTCTTCAGAAGCAGAGCCGTC -3'

Posted On

2019-05-15