Mutagenetix > Incidental Mutation

Incidental Mutation 'R7116:Lamb2'

551783

Institutional Source

Beutler Lab

Gene Symbol

Lamb2

Ensembl Gene

ENSMUSG00000052911

Gene Name

laminin, beta 2

Synonyms

Lams, npht, Lamb-2

MMRRC Submission

Accession Numbers

Genbank: NM_008483; MGI: 99916

Essential gene?

Probably essential (E-score: 0.816) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108479736-108490530 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108487323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1121 (F1121L)

Ref Sequence

ENSEMBL: ENSMUSP00000069087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]

AlphaFold

Q61292

Predicted Effect

probably benign
Transcript: ENSMUST00000006854

SMART Domains

Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	1.3e-6	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	414	7.1e-19	PFAM
Pfam:USP19_linker	415	537	2.2e-61	PFAM
Pfam:UCH	538	1253	1.2e-77	PFAM
Pfam:UCH_1	539	874	8.6e-11	PFAM
Pfam:zf-MYND	833	875	9.9e-11	PFAM
Pfam:UCH_1	1021	1235	7.1e-10	PFAM
low complexity region	1278	1287	N/A	INTRINSIC
low complexity region	1301	1312	N/A	INTRINSIC
transmembrane domain	1333	1355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000065014
AA Change: F1121L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911
AA Change: F1121L

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamNT	44	284	1.9e-102	SMART
EGF_Lam	286	347	1.34e-6	SMART
EGF_Lam	350	410	6.1e-10	SMART
EGF_Lam	413	470	2.98e-13	SMART
EGF_Lam	473	522	7.93e-9	SMART
EGF_Lam	525	569	1.01e-10	SMART
EGF_Lam	784	829	3.42e-13	SMART
EGF_Lam	832	875	6.54e-10	SMART
EGF_Lam	878	925	1.34e-6	SMART
EGF_Lam	928	984	4.74e-7	SMART
EGF_Lam	987	1036	1.53e-10	SMART
EGF_Lam	1039	1093	6.29e-12	SMART
EGF_Lam	1096	1141	1.79e-7	SMART
EGF_Lam	1144	1188	6.64e-11	SMART
coiled coil region	1261	1299	N/A	INTRINSIC
low complexity region	1445	1458	N/A	INTRINSIC
coiled coil region	1473	1527	N/A	INTRINSIC
low complexity region	1609	1625	N/A	INTRINSIC
SCOP:d1eq1a_	1632	1786	5e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000085044

SMART Domains

Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	4.7e-7	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	414	2.5e-15	PFAM
low complexity region	449	460	N/A	INTRINSIC
low complexity region	524	530	N/A	INTRINSIC
Pfam:UCH	538	1253	7.4e-84	PFAM
Pfam:UCH_1	539	879	2.3e-13	PFAM
Pfam:zf-MYND	833	875	2.4e-10	PFAM
Pfam:UCH_1	1020	1235	2.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166103

SMART Domains

Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	2.6e-7	PFAM
low complexity region	257	268	N/A	INTRINSIC
Pfam:CS	326	390	3.9e-9	PFAM
low complexity region	425	436	N/A	INTRINSIC
low complexity region	500	506	N/A	INTRINSIC
Pfam:UCH	514	1229	1.8e-84	PFAM
Pfam:UCH_1	515	855	5.5e-14	PFAM
Pfam:zf-MYND	809	851	1.7e-10	PFAM
Pfam:UCH_1	996	1211	6.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000178075

SMART Domains

Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	1e-6	PFAM
low complexity region	258	269	N/A	INTRINSIC
Pfam:CS	327	415	5.4e-15	PFAM
low complexity region	450	461	N/A	INTRINSIC
low complexity region	525	531	N/A	INTRINSIC
Pfam:UCH	539	1254	4.9e-84	PFAM
Pfam:UCH_1	540	880	1.4e-13	PFAM
Pfam:zf-MYND	834	876	5.2e-10	PFAM
Pfam:UCH_1	1021	1236	1.8e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193678

SMART Domains

Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

Domain	Start	End	E-Value	Type
Pfam:CS	55	129	6.8e-7	PFAM
low complexity region	258	269	N/A	INTRINSIC
Pfam:CS	327	415	3.6e-15	PFAM
low complexity region	448	459	N/A	INTRINSIC
low complexity region	523	529	N/A	INTRINSIC
Pfam:UCH	537	1252	3.8e-84	PFAM
Pfam:UCH_1	538	878	1.1e-13	PFAM
Pfam:zf-MYND	832	874	5.1e-10	PFAM
Pfam:UCH_1	1019	1234	1.4e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Lamb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01370:Lamb2	APN	9	108487733	splice site	probably null
IGL02072:Lamb2	APN	9	108481908	nonsense	probably null
IGL02079:Lamb2	APN	9	108482113	missense	probably damaging	1.00
IGL02087:Lamb2	APN	9	108487119	missense	possibly damaging	0.95
IGL02193:Lamb2	APN	9	108489360	missense	probably benign	0.00
IGL02199:Lamb2	APN	9	108480625	missense	possibly damaging	0.49
IGL02201:Lamb2	APN	9	108487542	missense	probably damaging	1.00
IGL02468:Lamb2	APN	9	108487149	missense	probably damaging	1.00
F6893:Lamb2	UTSW	9	108482556	missense	probably benign	0.12
R0053:Lamb2	UTSW	9	108486737	nonsense	probably null
R0053:Lamb2	UTSW	9	108486737	nonsense	probably null
R0122:Lamb2	UTSW	9	108486514	missense	probably benign	0.01
R0452:Lamb2	UTSW	9	108486354	unclassified	probably benign
R0524:Lamb2	UTSW	9	108484372	missense	possibly damaging	0.90
R0605:Lamb2	UTSW	9	108486105	unclassified	probably benign
R0737:Lamb2	UTSW	9	108483794	missense	probably benign	0.03
R1083:Lamb2	UTSW	9	108483693	missense	probably benign
R1159:Lamb2	UTSW	9	108481408	missense	probably damaging	1.00
R1283:Lamb2	UTSW	9	108481808	missense	possibly damaging	0.46
R1507:Lamb2	UTSW	9	108490382	missense	probably damaging	1.00
R1547:Lamb2	UTSW	9	108482625	missense	probably benign	0.00
R1576:Lamb2	UTSW	9	108480307	missense	probably damaging	0.96
R1647:Lamb2	UTSW	9	108481423	critical splice donor site	probably null
R1678:Lamb2	UTSW	9	108483686	critical splice acceptor site	probably null
R1740:Lamb2	UTSW	9	108481928	missense	probably damaging	1.00
R1803:Lamb2	UTSW	9	108488099	missense	probably benign
R1846:Lamb2	UTSW	9	108487387	missense	probably benign	0.00
R1863:Lamb2	UTSW	9	108481384	missense	probably benign	0.13
R2184:Lamb2	UTSW	9	108480553	missense	probably damaging	1.00
R2262:Lamb2	UTSW	9	108480610	missense	probably damaging	1.00
R2338:Lamb2	UTSW	9	108482141	missense	probably benign	0.20
R2483:Lamb2	UTSW	9	108480559	missense	probably damaging	1.00
R4084:Lamb2	UTSW	9	108488018	missense	probably benign	0.17
R4164:Lamb2	UTSW	9	108490298	missense	probably damaging	1.00
R4295:Lamb2	UTSW	9	108486211	missense	probably benign	0.42
R4422:Lamb2	UTSW	9	108483555	missense	probably damaging	0.99
R4497:Lamb2	UTSW	9	108486798	missense	probably damaging	1.00
R4880:Lamb2	UTSW	9	108484027	splice site	probably null
R4935:Lamb2	UTSW	9	108487501	missense	possibly damaging	0.93
R4977:Lamb2	UTSW	9	108487647	missense	probably damaging	0.99
R5152:Lamb2	UTSW	9	108487738	missense	probably benign
R5499:Lamb2	UTSW	9	108487802	missense	possibly damaging	0.50
R5724:Lamb2	UTSW	9	108480751	splice site	probably null
R5932:Lamb2	UTSW	9	108480611	missense	probably damaging	1.00
R5997:Lamb2	UTSW	9	108480388	missense	possibly damaging	0.65
R6052:Lamb2	UTSW	9	108487612	nonsense	probably null
R6142:Lamb2	UTSW	9	108485618	nonsense	probably null
R6245:Lamb2	UTSW	9	108488199	splice site	probably null
R6531:Lamb2	UTSW	9	108483726	missense	possibly damaging	0.78
R6557:Lamb2	UTSW	9	108488400	missense	probably damaging	1.00
R6562:Lamb2	UTSW	9	108487008	missense	possibly damaging	0.56
R6997:Lamb2	UTSW	9	108481297	missense	probably damaging	1.00
R7024:Lamb2	UTSW	9	108489488	missense	probably benign	0.00
R7146:Lamb2	UTSW	9	108484084	missense	possibly damaging	0.94
R7261:Lamb2	UTSW	9	108481297	missense	probably damaging	1.00
R7288:Lamb2	UTSW	9	108488324	missense	probably benign	0.20
R7404:Lamb2	UTSW	9	108487583	missense	probably damaging	1.00
R7456:Lamb2	UTSW	9	108485780	missense	possibly damaging	0.95
R7472:Lamb2	UTSW	9	108486148	missense	probably benign	0.01
R7623:Lamb2	UTSW	9	108489224	missense	possibly damaging	0.62
R8125:Lamb2	UTSW	9	108487523	missense	probably benign
R8153:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8154:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8155:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8156:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8157:Lamb2	UTSW	9	108480646	missense	probably damaging	0.99
R8419:Lamb2	UTSW	9	108488364	missense	probably benign	0.00
R8695:Lamb2	UTSW	9	108486166	missense	probably benign	0.08
R8825:Lamb2	UTSW	9	108485261	missense	probably benign	0.01
R9005:Lamb2	UTSW	9	108484171	critical splice donor site	probably null
R9315:Lamb2	UTSW	9	108487167	missense	possibly damaging	0.77
R9398:Lamb2	UTSW	9	108487167	missense	possibly damaging	0.77
R9419:Lamb2	UTSW	9	108479760	missense	unknown
R9450:Lamb2	UTSW	9	108480561	nonsense	probably null
R9495:Lamb2	UTSW	9	108480807	missense	probably damaging	1.00
R9514:Lamb2	UTSW	9	108480807	missense	probably damaging	1.00
R9529:Lamb2	UTSW	9	108486278	missense	probably benign	0.05
R9532:Lamb2	UTSW	9	108488631	missense	probably damaging	1.00
R9534:Lamb2	UTSW	9	108488631	missense	probably damaging	1.00
R9734:Lamb2	UTSW	9	108488631	missense	probably damaging	1.00
Z1176:Lamb2	UTSW	9	108482901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACTGTGACCATTGTGCC -3'
(R):5'- AGGATCACAGTCACAGGCTG -3'

Sequencing Primer
(F):5'- TTGGAACTTCACCAGTGGC -3'
(R):5'- TCACAGGCTGCAAGAAAAGC -3'

Posted On

2019-05-15