Mutagenetix > Incidental Mutation

Incidental Mutation 'R7116:Pfkl'

551784

Institutional Source

Beutler Lab

Gene Symbol

Pfkl

Ensembl Gene

ENSMUSG00000020277

Gene Name

phosphofructokinase, liver, B-type

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77986947-78010083 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78001415 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 108 (H108R)

Ref Sequence

ENSEMBL: ENSMUSP00000020522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000145716] [ENSMUST00000218383]

AlphaFold

P12382

Predicted Effect

probably benign
Transcript: ENSMUST00000020522
AA Change: H108R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277
AA Change: H108R

Domain	Start	End	E-Value	Type
Pfam:PFK	17	324	4.7e-109	PFAM
Pfam:PFK	401	686	1.9e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145716
AA Change: H79R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218383

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Pfkl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Pfkl	APN	10	77991395	missense	probably benign
IGL01759:Pfkl	APN	10	78000731	missense	probably damaging	1.00
IGL02697:Pfkl	APN	10	77999918	missense	probably benign	0.09
IGL02870:Pfkl	APN	10	78000839	nonsense	probably null
IGL02942:Pfkl	APN	10	78000133	critical splice donor site	probably null
IGL02972:Pfkl	APN	10	77988274	missense	probably benign	0.00
IGL03342:Pfkl	APN	10	78005475	missense	possibly damaging	0.95
ANU23:Pfkl	UTSW	10	77991395	missense	probably benign
R0226:Pfkl	UTSW	10	77992534	missense	probably benign	0.00
R0743:Pfkl	UTSW	10	77995243	critical splice donor site	probably null
R0899:Pfkl	UTSW	10	78005439	critical splice donor site	probably null
R0926:Pfkl	UTSW	10	78000689	missense	probably damaging	1.00
R1264:Pfkl	UTSW	10	77993416	missense	possibly damaging	0.46
R1782:Pfkl	UTSW	10	77988720	missense	probably benign	0.00
R1918:Pfkl	UTSW	10	78001426	missense	probably damaging	1.00
R3743:Pfkl	UTSW	10	77996345	missense	probably damaging	1.00
R4559:Pfkl	UTSW	10	77988883	missense	probably benign	0.00
R4804:Pfkl	UTSW	10	77991394	missense	probably benign
R4823:Pfkl	UTSW	10	77997594	missense	probably damaging	1.00
R4906:Pfkl	UTSW	10	77988310	missense	probably damaging	1.00
R5082:Pfkl	UTSW	10	77996408	missense	probably damaging	1.00
R5216:Pfkl	UTSW	10	78009670	missense	probably damaging	0.99
R5380:Pfkl	UTSW	10	77997589	missense	possibly damaging	0.86
R5816:Pfkl	UTSW	10	78002022	missense	possibly damaging	0.75
R5840:Pfkl	UTSW	10	77988724	missense	probably benign
R5888:Pfkl	UTSW	10	77991370	missense	possibly damaging	0.68
R6143:Pfkl	UTSW	10	77989613	missense	probably damaging	0.96
R6152:Pfkl	UTSW	10	77990151	missense	probably benign	0.00
R6251:Pfkl	UTSW	10	77989565	critical splice donor site	probably null
R6262:Pfkl	UTSW	10	77988673	critical splice donor site	probably null
R6382:Pfkl	UTSW	10	77999837	missense	probably damaging	0.98
R6407:Pfkl	UTSW	10	77988673	critical splice donor site	probably null
R6547:Pfkl	UTSW	10	77995354	missense	probably benign
R6704:Pfkl	UTSW	10	77996366	missense	probably damaging	1.00
R6996:Pfkl	UTSW	10	77997589	missense	probably damaging	1.00
R7154:Pfkl	UTSW	10	78001455	missense	probably benign	0.41
R7183:Pfkl	UTSW	10	78002082	nonsense	probably null
R7248:Pfkl	UTSW	10	77989589	missense	probably damaging	1.00
R7252:Pfkl	UTSW	10	77993429	missense	probably damaging	1.00
R7278:Pfkl	UTSW	10	77992023	missense	probably damaging	0.99
R7974:Pfkl	UTSW	10	77994162	missense	probably damaging	1.00
R8686:Pfkl	UTSW	10	77997522	critical splice donor site	probably null
R8900:Pfkl	UTSW	10	78000781	missense	probably damaging	1.00
R9015:Pfkl	UTSW	10	77988960	missense	probably damaging	0.98
R9090:Pfkl	UTSW	10	77997592	missense	probably benign	0.28
R9257:Pfkl	UTSW	10	77989655	missense	probably damaging	1.00
R9271:Pfkl	UTSW	10	77997592	missense	probably benign	0.28
R9415:Pfkl	UTSW	10	77988247	missense	probably damaging	1.00
R9439:Pfkl	UTSW	10	77995338	missense	probably damaging	1.00
R9486:Pfkl	UTSW	10	77988350	missense	probably benign
R9703:Pfkl	UTSW	10	77990308	critical splice acceptor site	probably null
X0026:Pfkl	UTSW	10	77989643	missense	probably damaging	1.00
Z1176:Pfkl	UTSW	10	78000136	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGACCTTATGACCTGCAGAC -3'
(R):5'- AGATTCTAGAGGCTTCTCCCC -3'

Sequencing Primer
(F):5'- TGACCTTATGACCTGCAGACTATAC -3'
(R):5'- CTCCCCTGTTTAATTCTGTGGGG -3'

Posted On

2019-05-15