Mutagenetix > Incidental Mutations

Incidental Mutation 'R7116:Actn1'

551790

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.444) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80204977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 109 (S109P)

Ref Sequence

ENSEMBL: ENSMUSP00000021554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

AlphaFold

Q7TPR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000021554
AA Change: S109P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: S109P

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167327
AA Change: S109P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: S109P

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1519:Actn1	UTSW	12	80205078	missense	probably damaging	1.00
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4024:Actn1	UTSW	12	80168477	missense	probably damaging	1.00
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R4972:Actn1	UTSW	12	80173039	missense	probably benign	0.35
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R6709:Actn1	UTSW	12	80193644	missense	probably damaging	1.00
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7183:Actn1	UTSW	12	80168932	missense	possibly damaging	0.87
R7291:Actn1	UTSW	12	80174085	missense	probably benign	0.00
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null
R8469:Actn1	UTSW	12	80193683	missense	possibly damaging	0.95
R8794:Actn1	UTSW	12	80198980	critical splice donor site	probably benign
R8887:Actn1	UTSW	12	80168423	missense	probably damaging	1.00
R9237:Actn1	UTSW	12	80193696	missense	possibly damaging	0.92
R9269:Actn1	UTSW	12	80172971	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAACAGGTGAGGCGTTCCAC -3'
(R):5'- CGCATGCCCATTTAAGAAACGC -3'

Sequencing Primer
(F):5'- CGTTCCACGTGCAACTGC -3'
(R):5'- CCATTTAAGAAACGCTTTGGCCG -3'

Posted On

2019-05-15