Mutagenetix > Incidental Mutations

Incidental Mutation 'R7116:Hira'

551801

Institutional Source

Beutler Lab

Gene Symbol

Hira

Ensembl Gene

ENSMUSG00000022702

Gene Name

histone cell cycle regulator

Synonyms

D16Ertd95e, Gm15797, Tuple1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18877037-18970309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18912114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 188 (Y188H)

Ref Sequence

ENSEMBL: ENSMUSP00000004222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000120532] [ENSMUST00000128321] [ENSMUST00000144609] [ENSMUST00000153397] [ENSMUST00000190050]

AlphaFold

Q61666

Predicted Effect

probably damaging
Transcript: ENSMUST00000004222
AA Change: Y188H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: Y188H

Domain	Start	End	E-Value	Type
WD40	1	44	1.56e-1	SMART
WD40	59	98	9.67e-7	SMART
WD40	120	159	3.58e-10	SMART
WD40	163	202	7.22e-6	SMART
WD40	212	254	9.17e1	SMART
WD40	257	313	1.54e0	SMART
WD40	319	356	2.86e0	SMART
low complexity region	405	412	N/A	INTRINSIC
Pfam:HIRA_B	448	470	1.9e-10	PFAM
low complexity region	493	507	N/A	INTRINSIC
low complexity region	540	556	N/A	INTRINSIC
low complexity region	600	614	N/A	INTRINSIC
low complexity region	626	641	N/A	INTRINSIC
Pfam:Hira	761	960	2.9e-61	PFAM
low complexity region	979	989	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120532
AA Change: Y144H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112614
Gene: ENSMUSG00000022702
AA Change: Y144H

Domain	Start	End	E-Value	Type
WD40	15	54	9.67e-7	SMART
WD40	76	115	3.58e-10	SMART
WD40	119	158	7.22e-6	SMART
WD40	168	210	9.17e1	SMART
WD40	213	269	1.54e0	SMART
WD40	275	312	2.86e0	SMART
low complexity region	361	368	N/A	INTRINSIC
Pfam:HIRA_B	404	427	1.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128321

Predicted Effect

probably benign
Transcript: ENSMUST00000144609

Predicted Effect

probably benign
Transcript: ENSMUST00000153397

SMART Domains

Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702

Domain	Start	End	E-Value	Type
Blast:WD40	1	40	1e-18	BLAST
SCOP:d1erja_	7	33	3e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190050

SMART Domains

Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

Domain	Start	End	E-Value	Type
low complexity region	26	37	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Hira

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00560:Hira	APN	16	18946340	splice site	probably benign
IGL01285:Hira	APN	16	18912180	missense	probably benign	0.01
F5770:Hira	UTSW	16	18894821	missense	probably damaging	1.00
IGL02796:Hira	UTSW	16	18925654	missense	probably benign	0.01
R0123:Hira	UTSW	16	18956171	missense	probably benign	0.45
R0225:Hira	UTSW	16	18956171	missense	probably benign	0.45
R0606:Hira	UTSW	16	18935047	missense	probably benign	0.00
R1017:Hira	UTSW	16	18899347	splice site	probably null
R1456:Hira	UTSW	16	18925663	missense	probably benign	0.02
R1479:Hira	UTSW	16	18896469	missense	probably damaging	1.00
R1731:Hira	UTSW	16	18933014	missense	probably benign	0.01
R1830:Hira	UTSW	16	18947414	missense	probably damaging	1.00
R2039:Hira	UTSW	16	18951701	missense	probably benign	0.05
R4328:Hira	UTSW	16	18896612	missense	probably benign	0.01
R4401:Hira	UTSW	16	18925720	missense	probably damaging	1.00
R4423:Hira	UTSW	16	18956202	missense	possibly damaging	0.80
R4634:Hira	UTSW	16	18946400	missense	probably damaging	0.98
R4728:Hira	UTSW	16	18922904	missense	probably damaging	1.00
R5050:Hira	UTSW	16	18925859	missense	possibly damaging	0.75
R5139:Hira	UTSW	16	18954758	missense	probably damaging	1.00
R5201:Hira	UTSW	16	18952115	missense	probably damaging	0.98
R5327:Hira	UTSW	16	18954758	missense	probably damaging	1.00
R5483:Hira	UTSW	16	18969540	missense	possibly damaging	0.89
R5573:Hira	UTSW	16	18916599	missense	probably damaging	1.00
R5626:Hira	UTSW	16	18927512	missense	probably damaging	0.97
R5768:Hira	UTSW	16	18935018	splice site	probably benign
R5952:Hira	UTSW	16	18935065	missense	possibly damaging	0.83
R6128:Hira	UTSW	16	18932977	missense	probably benign	0.08
R6280:Hira	UTSW	16	18910707	missense	probably damaging	1.00
R7363:Hira	UTSW	16	18897782	missense	possibly damaging	0.64
R7497:Hira	UTSW	16	18952079	missense	probably damaging	0.99
R8059:Hira	UTSW	16	18912151	missense	probably damaging	0.97
R8079:Hira	UTSW	16	18925757	missense	probably benign	0.34
R8167:Hira	UTSW	16	18896509	missense	probably benign
R8199:Hira	UTSW	16	18947444	missense	probably benign
R8256:Hira	UTSW	16	18925693	missense	probably benign	0.00
R8404:Hira	UTSW	16	18952162	missense	possibly damaging	0.75
R8877:Hira	UTSW	16	18952104	missense	probably benign	0.08
R8928:Hira	UTSW	16	18897787	missense	probably benign
R8984:Hira	UTSW	16	18927511	missense	possibly damaging	0.78
R9391:Hira	UTSW	16	18949142	missense	possibly damaging	0.92
R9418:Hira	UTSW	16	18951275	missense	probably benign	0.00
V7581:Hira	UTSW	16	18894821	missense	probably damaging	1.00
V7582:Hira	UTSW	16	18894821	missense	probably damaging	1.00
Z1177:Hira	UTSW	16	18912149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAAGTTAGACTGCTCAGGTCC -3'
(R):5'- TAGAGACCCCTAAACTGCATGC -3'

Sequencing Primer
(F):5'- AGACTGCTCAGGTCCCTTCG -3'
(R):5'- GACTGTTTCCGTTACCTCA -3'

Posted On

2019-05-15