Incidental Mutation 'R7116:H2-Aa'

• ID: 551802
• Institutional Source: Beutler Lab
• Gene Symbol: H2-Aa
• Ensembl Gene: ENSMUSG00000036594
• Gene Name: histocompatibility 2, class II antigen A, alpha
• Synonyms: Ia1, I-Aalpha, H-2Aa, A alpha, Aalpha, Ia-1
• MMRRC Submission: 045207-MU
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R7116 (G1)
• Quality Score: 225.009
• Status: Not validated
• Chromosome: 17
• Chromosomal Location: 34501718-34506797 bp(-) (GRCm39)
• Type of Mutation: nonsense
• DNA Base Change (assembly): A to T at 34502601 bp (GRCm39)
• Zygosity: Heterozygous
• Amino Acid Change: Tyrosine to Stop codon at position 188 (Y188*)
• Ref Sequence: ENSEMBL: ENSMUSP00000046105
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000040655] [ENSMUST00000174751]
• AlphaFold: no structure available at present
• PDB Structure: CRYSTAL STRUCTURE OF CLASS II MHC MOLECULE IAb BOUND TO EALPHA3K PEPTIDE [X-RAY DIFFRACTION] ; Crystal structure of murine class II MHC I-Ab in complex with a human CLIP peptide [X-RAY DIFFRACTION] ; Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR B3K506 [X-RAY DIFFRACTION] ; Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR YAe62 [X-RAY DIFFRACTION] ; Crystal structure of mouse MHC class II I-Ab/3K peptide complexed with mouse TCR 2W20 [X-RAY DIFFRACTION] ; Crystal Structure of 809.B5 TCR complexed with MHC Class II I-Ab/3k peptide [X-RAY DIFFRACTION] ; J809.B5 TCR bound to IAb/3K [X-RAY DIFFRACTION] ; J809.B5 Y31A TCR bound to IAb3K [X-RAY DIFFRACTION] ; 14.C6 TCR complexed with MHC class II I-Ab/3K peptide [X-RAY DIFFRACTION]
• Predicted Effect: probably null; Transcript: ENSMUST00000040655; AA Change: Y188*
• SMART Domains: Protein: ENSMUSP00000046105; Gene: ENSMUSG00000036594; AA Change: Y188*

Domain	Start	End	E-Value	Type
MHC_II_alpha	31	111	1.83e-45	SMART
IGc1	129	200	2.51e-27	SMART
Pfam:C1-set_C	203	255	2.1e-30	PFAM

• Predicted Effect: probably null; Transcript: ENSMUST00000174751; AA Change: Y105*
• SMART Domains: Protein: ENSMUSP00000133399; Gene: ENSMUSG00000036594; AA Change: Y105*

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc1	46	117	2.51e-27	SMART
low complexity region	141	158	N/A	INTRINSIC

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele lack cell surface expression of MHC class II molecules on macrophages and show decreased CD4-positive T cell number, increased CD8-positive T cell number, thymus hyperplasia, enlarged lymph nodes, and altered splenocyte response to staphylococcal enterotoxin B. [provided by MGI curators]
• Posted On: 2019-05-15

Predicted Primers

PCR Primer
(F):5'- TGGGCTTATGGAATGACATGAAATC -3'
(R):5'- AAGCGACTGTGTTCCCCAAG -3'

Sequencing Primer
(F):5'- GGAATGACATGAAATCTAGCTTTAGG -3'
(R):5'- AAGTCCCCTGTGCTGCTG -3'