Mutagenetix > Incidental Mutations

Incidental Mutation 'R7116:Stip1'

551804

Institutional Source

Beutler Lab

Gene Symbol

Stip1

Ensembl Gene

ENSMUSG00000024966

Gene Name

stress-induced phosphoprotein 1

Synonyms

Hop, IEF SSP 3521, Hsp70/Hsp90 organizing protein, STI1, p60

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7116 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7020696-7040026 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 7021810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 467 (G467S)

Ref Sequence

ENSEMBL: ENSMUSP00000025918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025918] [ENSMUST00000040772]

AlphaFold

Q60864

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025918
AA Change: G467S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025918
Gene: ENSMUSG00000024966
AA Change: G467S

Domain	Start	End	E-Value	Type
TPR	4	37	3.07e-5	SMART
TPR	38	71	1.63e0	SMART
TPR	72	105	5.87e-2	SMART
STI1	130	169	4.84e-1	SMART
low complexity region	192	220	N/A	INTRINSIC
TPR	225	258	7.45e-4	SMART
TPR	259	292	1.1e-1	SMART
TPR	300	333	1.09e-5	SMART
TPR	360	393	1.07e-4	SMART
TPR	394	427	9.45e-6	SMART
TPR	428	461	3.29e-5	SMART
STI1	492	531	1.66e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040772

SMART Domains

Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965

Domain	Start	End	E-Value	Type
Blast:B41	14	77	6e-32	BLAST
B41	94	556	1.66e-28	SMART
PH	350	455	2.26e-12	SMART

Meta Mutation Damage Score

0.5146

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality by E10.5, actute inflammation in the placental labyrinth, poorly formed neural tube and limb buds and increase double-strand breaks. Mice heterozygous for this allele exhibit susceptibility to ischemic brain injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	A	G	12: 80,204,977	S109P	probably damaging	Het
Afg3l1	T	G	8: 123,489,862	L280R	probably damaging	Het
Akap13	T	A	7: 75,720,195	S129T	probably benign	Het
Ankrd11	A	G	8: 122,896,130	S328P	probably damaging	Het
Aox3	A	T	1: 58,153,530	E554D	probably benign	Het
Bcl11a	T	C	11: 24,163,839	V394A	probably damaging	Het
Cass4	A	G	2: 172,427,969	Y657C	unknown	Het
Ccdc88a	C	T	11: 29,504,051	A1738V	probably benign	Het
Cfap74	T	C	4: 155,455,061	F948L	unknown	Het
Chgb	A	T	2: 132,781,317		probably benign	Het
Coro1c	C	T	5: 113,852,206	W138*	probably null	Het
Dgkb	A	G	12: 37,981,990	Q17R	probably benign	Het
Esco2	A	G	14: 65,826,557	Y393H	probably damaging	Het
Eya3	T	A	4: 132,694,799	D228E	probably benign	Het
Fat2	T	C	11: 55,282,336	D2517G	probably damaging	Het
Fry	T	A	5: 150,395,869		probably null	Het
Gal3st2b	A	T	1: 93,940,776	Q243L	possibly damaging	Het
Gimap9	C	T	6: 48,678,055	A192V	probably benign	Het
Glg1	T	A	8: 111,178,957	Q564L	probably benign	Het
H2-Aa	A	T	17: 34,283,627	Y188*	probably null	Het
Hira	T	C	16: 18,912,114	Y188H	probably damaging	Het
Ighv8-8	C	T	12: 115,294,194	D76N	probably benign	Het
Irf6	T	C	1: 193,167,597	F276L	probably damaging	Het
Itpr1	T	C	6: 108,481,268	C2000R	probably damaging	Het
Jakmip3	T	C	7: 139,020,250	V293A	possibly damaging	Het
Kcnh7	A	G	2: 62,877,270	V132A	probably benign	Het
Kcnj1	A	G	9: 32,396,981	T234A	possibly damaging	Het
Kpna3	T	A	14: 61,368,186	N470I	probably benign	Het
Lamb2	T	C	9: 108,487,323	F1121L	probably damaging	Het
Lingo1	T	C	9: 56,620,627	D232G	probably benign	Het
Lpxn	T	A	19: 12,811,258	N70K	probably benign	Het
Ltbp4	T	A	7: 27,305,427	H1657L	probably damaging	Het
Luzp2	C	A	7: 55,265,330	F334L	possibly damaging	Het
Mgat5b	A	T	11: 116,944,959	S142C	possibly damaging	Het
Mroh7	G	A	4: 106,711,320	T396I	probably benign	Het
Muc5b	T	C	7: 141,863,750	S3478P	probably benign	Het
Nfatc2	A	T	2: 168,507,349	M626K	probably benign	Het
Nlrp14	A	G	7: 107,183,048	D484G	possibly damaging	Het
Npc1	T	C	18: 12,211,544	Y423C	probably damaging	Het
Nrsn1	A	G	13: 25,253,405	I180T	probably damaging	Het
Olfr570	T	A	7: 102,900,635	N89K	probably benign	Het
Olfr741	A	T	14: 50,485,568	I37F	probably benign	Het
Osbpl6	A	T	2: 76,595,881	I935F	probably benign	Het
Otog	T	C	7: 46,298,265	F96L	probably damaging	Het
Pde1b	T	C	15: 103,528,318	L534P	possibly damaging	Het
Pdzd8	C	T	19: 59,299,693	E1092K	probably damaging	Het
Pfkl	T	C	10: 78,001,415	H108R	probably benign	Het
Pkhd1l1	G	A	15: 44,557,976	V3047I	probably benign	Het
Plag1	A	T	4: 3,904,812	C126*	probably null	Het
Pphln1	T	A	15: 93,455,525	S229T	probably benign	Het
Pramel5	C	T	4: 144,273,881	D42N	possibly damaging	Het
Psd3	A	G	8: 67,713,738	V915A	probably benign	Het
Ptdss1	T	A	13: 66,945,327	I77N	probably benign	Het
Rsbn1	T	A	3: 103,914,576	C3*	probably null	Het
Shank1	C	T	7: 44,327,161	A561V	unknown	Het
Sv2c	A	T	13: 95,976,644	V599E	probably damaging	Het
Vmn2r37	T	C	7: 9,217,899	T322A	probably benign	Het
Vmn2r60	T	A	7: 42,137,063	M430K	probably benign	Het
Wipf3	T	A	6: 54,481,919		probably null	Het

Other mutations in Stip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Stip1	APN	19	7021096	unclassified	probably benign
IGL02506:Stip1	APN	19	7035489	splice site	probably benign
IGL02515:Stip1	APN	19	7022119	missense	probably benign	0.23
IGL03009:Stip1	APN	19	7021121	missense	probably damaging	1.00
Whisp	UTSW	19	7021810	missense	possibly damaging	0.92
R1768:Stip1	UTSW	19	7021797	missense	probably damaging	1.00
R3081:Stip1	UTSW	19	7035648	missense	probably benign	0.42
R4530:Stip1	UTSW	19	7035658	missense	probably benign	0.04
R4965:Stip1	UTSW	19	7035570	missense	probably benign	0.41
R5638:Stip1	UTSW	19	7032515	missense	probably damaging	1.00
R5776:Stip1	UTSW	19	7022025	critical splice donor site	probably null
R5840:Stip1	UTSW	19	7022068	missense	possibly damaging	0.86
R7064:Stip1	UTSW	19	7035557	missense	probably benign	0.18
R7096:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7109:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7111:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7117:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7127:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7129:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7130:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7132:Stip1	UTSW	19	7021810	missense	possibly damaging	0.92
R7776:Stip1	UTSW	19	7021773	missense	probably benign	0.06
R8293:Stip1	UTSW	19	7034250	missense	probably benign
R8924:Stip1	UTSW	19	7025319	missense	probably damaging	1.00
Z1176:Stip1	UTSW	19	7022308	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCAGGCACATAACCTC -3'
(R):5'- AAGGTAAGCTGCTGTTGGCC -3'

Sequencing Primer
(F):5'- GAATGATAGAATTCCCTCTCACTTC -3'
(R):5'- AAGCTGCTGTTGGCCTATAAC -3'

Posted On

2019-05-15