Incidental Mutation 'R0598:Itgbl1'
ID55181
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission 038787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0598 (G1)
Quality Score223
Status Not validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123857436 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 167 (H167R)
Ref Sequence ENSEMBL: ENSMUSP00000115455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049681] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect probably benign
Transcript: ENSMUST00000049681
AA Change: H291R

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925
AA Change: H291R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000132026
AA Change: H167R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925
AA Change: H167R

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142161
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,404 S196L probably benign Het
3110035E14Rik T G 1: 9,619,842 I98S probably benign Het
4933427I04Rik A T 4: 123,860,888 E198D possibly damaging Het
Abca6 A T 11: 110,197,154 I1049N probably damaging Het
Acly A T 11: 100,478,390 N1014K probably damaging Het
Aph1c A T 9: 66,833,319 W42R probably damaging Het
Bptf G T 11: 107,072,965 T1738K probably damaging Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Cpt2 G T 4: 107,906,938 T543N probably damaging Het
Dnah9 T C 11: 66,118,877 E728G probably benign Het
Doxl2 A G 6: 48,975,537 E132G probably benign Het
Gm5689 T A 18: 42,173,371 M1K probably null Het
Kctd1 A G 18: 15,007,765 V40A probably damaging Het
L3mbtl4 T G 17: 68,459,773 D158E probably benign Het
Lrp8 A C 4: 107,857,237 I603L possibly damaging Het
Mrps9 C T 1: 42,905,417 T365I probably damaging Het
Olfr1389 A G 11: 49,431,403 D309G probably benign Het
Olfr20 G T 11: 73,353,903 R50L probably benign Het
Olfr403 A T 11: 74,195,832 T110S possibly damaging Het
Padi1 C A 4: 140,814,787 R608L possibly damaging Het
Pkhd1 A T 1: 20,200,890 F3146L probably damaging Het
Rnf145 T C 11: 44,548,943 S189P probably damaging Het
Sez6 G T 11: 77,977,821 D974Y possibly damaging Het
St3gal3 A T 4: 118,107,632 L11Q probably benign Het
Syt14 T C 1: 192,897,314 E554G probably damaging Het
Tectb G T 19: 55,189,586 E170* probably null Het
Themis2 A T 4: 132,789,683 C169S possibly damaging Het
Tmem88b A T 4: 155,784,367 D141E probably benign Het
Uaca T A 9: 60,870,921 Y685* probably null Het
Vsnl1 T C 12: 11,386,859 S40G probably benign Het
Wdr64 A T 1: 175,805,899 Q905H probably damaging Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0662:Itgbl1 UTSW 14 123827894 missense probably damaging 1.00
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1385:Itgbl1 UTSW 14 123661511 splice site probably null
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4434:Itgbl1 UTSW 14 123972199 missense probably damaging 1.00
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5087:Itgbl1 UTSW 14 123966739 missense possibly damaging 0.52
R5747:Itgbl1 UTSW 14 123972164 nonsense probably null
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7213:Itgbl1 UTSW 14 123973297 missense probably damaging 1.00
R7259:Itgbl1 UTSW 14 123843904 missense probably damaging 0.96
R7378:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
R7461:Itgbl1 UTSW 14 123827799 missense possibly damaging 0.88
R7664:Itgbl1 UTSW 14 123846550 missense probably damaging 1.00
R7841:Itgbl1 UTSW 14 123972233 critical splice donor site probably null
R7924:Itgbl1 UTSW 14 123972233 critical splice donor site probably null
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Z1176:Itgbl1 UTSW 14 123954672 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGGGATATGGGGAAGTCTCTCTAC -3'
(R):5'- TCTTTCTGAGACCTCAGGCACCAG -3'

Sequencing Primer
(F):5'- AATCCATCAAATACTCCACTTACTTC -3'
(R):5'- GGATGGGGGACATTTGATACATAC -3'
Posted On2013-07-11