Incidental Mutation 'R7117:Dnah7b'
ID 551810
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms Dnahc7b, LOC227058
MMRRC Submission 045208-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R7117 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 46066315-46373546 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 46352813 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293] [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000069293
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000069293
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185879
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
BB001:Dnah7b UTSW 1 46219430 missense probably benign 0.04
BB011:Dnah7b UTSW 1 46219430 missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 splice site probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
R7760:Dnah7b UTSW 1 46201253 missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46137474 missense probably benign
R7807:Dnah7b UTSW 1 46214367 missense probably benign
R7895:Dnah7b UTSW 1 46249950 missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46139678 missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46219430 missense probably benign 0.04
R7944:Dnah7b UTSW 1 46227003 missense probably benign
R7946:Dnah7b UTSW 1 46233579 missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46243424 missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46243365 missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46224706 nonsense probably null
R8094:Dnah7b UTSW 1 46126804 missense probably benign 0.01
R8137:Dnah7b UTSW 1 46233753 missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46253511 missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46356576 missense probably benign 0.43
R8309:Dnah7b UTSW 1 46139872 missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46175296 missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46356659 critical splice donor site probably null
R8438:Dnah7b UTSW 1 46188679 missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46290715 missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46099490 missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46116200 missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46175438 missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46182464 missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46352999 missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46123646 missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46234145 missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46191793 missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46241076 missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46253374 missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46223072 missense probably benign 0.00
R9058:Dnah7b UTSW 1 46243415 missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46134514 missense probably benign 0.01
R9131:Dnah7b UTSW 1 46227020 missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46142034 missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46290878 missense probably benign 0.06
R9223:Dnah7b UTSW 1 46322260 missense probably benign 0.12
R9391:Dnah7b UTSW 1 46233754 nonsense probably null
R9392:Dnah7b UTSW 1 46123738 nonsense probably null
R9456:Dnah7b UTSW 1 46126793 missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46214404 missense probably benign 0.27
R9553:Dnah7b UTSW 1 46225796 missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46253461 missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46213384 missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46337594 splice site probably null
RF020:Dnah7b UTSW 1 46373261 missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTTAGTCTGGGCCCAACACTC -3'
(R):5'- TGAAACGTCCCATCTCTTGG -3'

Sequencing Primer
(F):5'- GTCTGGGCCCAACACTCAGTATC -3'
(R):5'- CATCTCTTGGACAAGGACAGTGTTC -3'
Posted On 2019-05-15