Incidental Mutation 'R7117:Cr2'
ID 551813
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 045208-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7117 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 194842909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 244 (N244K)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: N244K

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: N244K

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193356
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: N244K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: N244K

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210219
AA Change: N620K

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,339,250 (GRCm39) Y254C probably benign Het
4930480E11Rik G T X: 77,414,311 (GRCm39) M345I probably benign Het
Adam12 T C 7: 133,518,191 (GRCm39) I650V probably benign Het
Adam39 G T 8: 41,279,279 (GRCm39) G557C probably damaging Het
Ak5 A G 3: 152,321,493 (GRCm39) probably null Het
Arhgef10l C T 4: 140,291,497 (GRCm39) probably null Het
Arhgef37 C T 18: 61,637,481 (GRCm39) E394K probably benign Het
Baz2b A G 2: 59,742,841 (GRCm39) V13A Het
Bnc1 G T 7: 81,623,109 (GRCm39) A706E possibly damaging Het
Bscl2 G A 19: 8,825,878 (GRCm39) A421T possibly damaging Het
Btn1a1 A C 13: 23,643,415 (GRCm39) W345G possibly damaging Het
C3 A T 17: 57,519,655 (GRCm39) M1199K probably benign Het
Ccdc18 T G 5: 108,296,835 (GRCm39) L213V possibly damaging Het
Cers2 T C 3: 95,228,072 (GRCm39) probably null Het
Chpt1 T A 10: 88,316,711 (GRCm39) H249L probably damaging Het
Cited2 A G 10: 17,600,364 (GRCm39) E224G possibly damaging Het
Cntn5 T A 9: 10,904,704 (GRCm39) probably benign Het
Col28a1 A G 6: 8,013,122 (GRCm39) S977P possibly damaging Het
Col6a1 T C 10: 76,560,843 (GRCm39) K52E probably damaging Het
Cpne2 T A 8: 95,282,172 (GRCm39) H239Q probably damaging Het
Csf2rb2 T C 15: 78,169,385 (GRCm39) D590G probably damaging Het
Defb25 A C 2: 152,464,380 (GRCm39) C55G probably damaging Het
Dnah7b A T 1: 46,391,973 (GRCm39) probably null Het
Dvl3 T A 16: 20,346,072 (GRCm39) Y467* probably null Het
Elapor2 T A 5: 9,495,384 (GRCm39) C729* probably null Het
Extl2 T C 3: 115,821,088 (GRCm39) S312P probably damaging Het
Fam178b T C 1: 36,639,548 (GRCm39) T313A probably benign Het
Fam186b A G 15: 99,183,471 (GRCm39) Y58H probably damaging Het
Fat1 A T 8: 45,484,505 (GRCm39) I3248L probably damaging Het
Fat2 A G 11: 55,172,088 (GRCm39) F2875S probably damaging Het
Flnb T A 14: 7,894,214 (GRCm38) N760K probably benign Het
Galnt14 T C 17: 73,801,190 (GRCm39) H544R probably benign Het
Gpr137c A C 14: 45,516,484 (GRCm39) R357S probably damaging Het
Grk2 A G 19: 4,340,630 (GRCm39) probably null Het
Hectd2 A T 19: 36,577,055 (GRCm39) T342S probably benign Het
Hjv G T 3: 96,435,542 (GRCm39) V267L possibly damaging Het
Ildr2 G T 1: 166,123,380 (GRCm39) G270C probably damaging Het
Insm2 C A 12: 55,647,357 (GRCm39) A367D probably damaging Het
Kcnh5 T A 12: 75,161,219 (GRCm39) I230F possibly damaging Het
Keg1 T A 19: 12,687,042 (GRCm39) S24T probably damaging Het
Kera A T 10: 97,448,714 (GRCm39) E311D probably benign Het
Kit T A 5: 75,767,758 (GRCm39) I47K probably benign Het
Megf6 A G 4: 154,343,379 (GRCm39) T663A possibly damaging Het
Mettl21c G A 1: 44,049,808 (GRCm39) A79V probably damaging Het
Mfsd1 T A 3: 67,507,391 (GRCm39) probably null Het
Mob3b A G 4: 34,985,914 (GRCm39) probably null Het
Morc2b T A 17: 33,356,926 (GRCm39) H282L probably benign Het
Mtpap T C 18: 4,380,889 (GRCm39) probably null Het
Mtus1 A G 8: 41,536,621 (GRCm39) V365A possibly damaging Het
Muc5ac T A 7: 141,367,559 (GRCm39) Y2993* probably null Het
Mycbp2 A C 14: 103,391,513 (GRCm39) F3422V probably benign Het
Ndufb7 T A 8: 84,297,490 (GRCm39) D48E probably benign Het
Nxpe5 A G 5: 138,237,704 (GRCm39) Y88C probably damaging Het
Or51a6 T A 7: 102,604,185 (GRCm39) M208L probably benign Het
Or5d3 A G 2: 88,174,905 (GRCm39) L64P probably damaging Het
Osbpl5 T A 7: 143,263,520 (GRCm39) D121V probably benign Het
Oxnad1 A T 14: 31,813,608 (GRCm39) H3L probably benign Het
Pam C A 1: 97,904,841 (GRCm39) probably benign Het
Papolg T C 11: 23,845,207 (GRCm39) probably benign Het
Pax1 G A 2: 147,208,190 (GRCm39) G266D probably damaging Het
Pde11a A T 2: 75,906,348 (GRCm39) M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Phf21a A T 2: 92,189,502 (GRCm39) Q587L probably benign Het
Plcb3 A G 19: 6,941,746 (GRCm39) L336P probably damaging Het
Pnp2 T C 14: 51,201,931 (GRCm39) *306Q probably null Het
Pou5f2 A G 13: 78,173,392 (GRCm39) I111M probably benign Het
Pramel32 T A 4: 88,547,195 (GRCm39) M246L probably damaging Het
Prmt3 G T 7: 49,467,843 (GRCm39) A350S probably benign Het
Rac3 A T 11: 120,614,343 (GRCm39) R163* probably null Het
Raly G T 2: 154,699,432 (GRCm39) V79L probably benign Het
Rbm20 A T 19: 53,839,989 (GRCm39) T993S possibly damaging Het
Rwdd3 A G 3: 120,964,987 (GRCm39) L56P probably benign Het
Serpina3a C T 12: 104,082,436 (GRCm39) H70Y possibly damaging Het
Sez6l2 A C 7: 126,552,915 (GRCm39) E227A possibly damaging Het
Shank1 C T 7: 43,976,585 (GRCm39) A561V unknown Het
Sidt2 C T 9: 45,864,517 (GRCm39) V71I probably benign Het
Slc35f6 T C 5: 30,815,051 (GRCm39) L326P probably damaging Het
Sox2 G A 3: 34,705,075 (GRCm39) G171S possibly damaging Het
Spef2 G A 15: 9,729,924 (GRCm39) R65C probably damaging Het
Spmap2 A T 10: 79,420,741 (GRCm39) probably null Het
Stip1 C T 19: 6,999,178 (GRCm39) G467S possibly damaging Het
Tada2a T A 11: 83,976,514 (GRCm39) I327F probably damaging Het
Tex2 A G 11: 106,435,071 (GRCm39) V785A unknown Het
Thada C A 17: 84,538,214 (GRCm39) probably null Het
Tmed1 G A 9: 21,420,550 (GRCm39) T94M possibly damaging Het
Tsr1 G T 11: 74,790,360 (GRCm39) M149I probably benign Het
Ttc8 T C 12: 98,942,761 (GRCm39) Y434H possibly damaging Het
Ttn A G 2: 76,578,519 (GRCm39) Y24125H probably damaging Het
Ttn G T 2: 76,552,253 (GRCm39) probably null Het
Ttn A G 2: 76,773,235 (GRCm39) I2435T unknown Het
Uggt2 T C 14: 119,251,938 (GRCm39) I1174M probably benign Het
Unc13b T C 4: 43,216,544 (GRCm39) I281T probably benign Het
Usp1 G T 4: 98,817,127 (GRCm39) K106N possibly damaging Het
Vwa3b A G 1: 37,174,634 (GRCm39) D15G Het
Zfp28 G A 7: 6,397,461 (GRCm39) C632Y probably damaging Het
Zfp68 T C 5: 138,604,580 (GRCm39) D581G probably benign Het
Zmynd10 A C 9: 107,424,716 (GRCm39) S21R probably benign Het
Zswim4 C T 8: 84,940,681 (GRCm39) R806H probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTGCTGTAAAACTGGCAGGC -3'
(R):5'- CCCGACATGCAAAGGTATCTTAC -3'

Sequencing Primer
(F):5'- AAACTGGCAGGCTTGACTTC -3'
(R):5'- CATTTACTATCTATTTGAGGCTGACC -3'
Posted On 2019-05-15