Incidental Mutation 'R7117:Phf21a'
ID551819
Institutional Source Beutler Lab
Gene Symbol Phf21a
Ensembl Gene ENSMUSG00000058318
Gene NamePHD finger protein 21A
SynonymsPFTF1, Bhc80, Braf35/HDAC complex (Bhc), 80kDa, D030065N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location92093117-92364666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92359157 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 587 (Q587L)
Ref Sequence ENSEMBL: ENSMUSP00000088074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068702] [ENSMUST00000090586] [ENSMUST00000111290] [ENSMUST00000111291] [ENSMUST00000111292] [ENSMUST00000111293] [ENSMUST00000111294] [ENSMUST00000111297] [ENSMUST00000159961]
Predicted Effect probably damaging
Transcript: ENSMUST00000044036
AA Change: Q503L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318
AA Change: Q503L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068702
AA Change: Q455L

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318
AA Change: Q455L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090586
AA Change: Q587L

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318
AA Change: Q587L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111290
AA Change: Q558L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318
AA Change: Q558L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111291
AA Change: Q503L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106922
Gene: ENSMUSG00000058318
AA Change: Q503L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111292
AA Change: Q455L

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106923
Gene: ENSMUSG00000058318
AA Change: Q455L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111293
AA Change: Q587L

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106924
Gene: ENSMUSG00000058318
AA Change: Q587L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111294
AA Change: Q540L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106925
Gene: ENSMUSG00000058318
AA Change: Q540L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
PHD 452 495 3.12e-15 SMART
RING 453 494 1.85e-1 SMART
coiled coil region 519 564 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111297
AA Change: Q510L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318
AA Change: Q510L

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159961
AA Change: Q474L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123955
Gene: ENSMUSG00000058318
AA Change: Q474L

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
low complexity region 57 100 N/A INTRINSIC
low complexity region 136 157 N/A INTRINSIC
AT_hook 321 333 4.28e-1 SMART
low complexity region 340 352 N/A INTRINSIC
PHD 386 429 3.12e-15 SMART
RING 387 428 1.85e-1 SMART
coiled coil region 453 498 N/A INTRINSIC
low complexity region 546 566 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124255
Gene: ENSMUSG00000058318
AA Change: Q224L

DomainStartEndE-ValueType
PHD 140 183 3.12e-15 SMART
RING 141 182 1.85e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and insufficient milk-sucking behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Phf21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Phf21a APN 2 92348029 missense probably damaging 1.00
IGL00826:Phf21a APN 2 92344536 splice site probably benign
IGL01859:Phf21a APN 2 92328356 missense probably damaging 1.00
IGL02124:Phf21a APN 2 92349422 missense probably damaging 1.00
IGL02724:Phf21a APN 2 92360247 missense probably damaging 1.00
IGL03155:Phf21a APN 2 92320266 missense probably damaging 0.99
R0308:Phf21a UTSW 2 92330777 missense possibly damaging 0.86
R1251:Phf21a UTSW 2 92359199 missense probably benign 0.00
R1739:Phf21a UTSW 2 92360299 missense possibly damaging 0.95
R1775:Phf21a UTSW 2 92330515 missense probably damaging 1.00
R2013:Phf21a UTSW 2 92228483 critical splice donor site probably null
R2064:Phf21a UTSW 2 92327077 missense possibly damaging 0.47
R2073:Phf21a UTSW 2 92348036 missense probably damaging 1.00
R4698:Phf21a UTSW 2 92356952 missense probably damaging 1.00
R4901:Phf21a UTSW 2 92357001 nonsense probably null
R5055:Phf21a UTSW 2 92351856 missense probably damaging 1.00
R5249:Phf21a UTSW 2 92228477 missense probably damaging 1.00
R5401:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R5770:Phf21a UTSW 2 92351854 missense possibly damaging 0.52
R5969:Phf21a UTSW 2 92221611 missense probably damaging 0.98
R6008:Phf21a UTSW 2 92351752 missense possibly damaging 0.71
R6012:Phf21a UTSW 2 92351775 missense probably damaging 1.00
R6128:Phf21a UTSW 2 92351608 critical splice acceptor site probably null
R6354:Phf21a UTSW 2 92348937 missense probably damaging 1.00
R7075:Phf21a UTSW 2 92360379 nonsense probably null
R7270:Phf21a UTSW 2 92327139 missense probably damaging 0.98
R7603:Phf21a UTSW 2 92357007 missense probably benign 0.08
R7708:Phf21a UTSW 2 92327166 critical splice donor site probably null
R7946:Phf21a UTSW 2 92359167 missense probably damaging 0.99
Z1177:Phf21a UTSW 2 92230714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATAAAGCCTGGCTCAAGC -3'
(R):5'- ACATGGCCATAGCACATGAGTG -3'

Sequencing Primer
(F):5'- AAGCCCATGGAGTCAGGTTCTG -3'
(R):5'- CACATGAGTGCTGCACGGTAATTC -3'
Posted On2019-05-15