Incidental Mutation 'R0598:L3mbtl4'
ID55182
Institutional Source Beutler Lab
Gene Symbol L3mbtl4
Ensembl Gene ENSMUSG00000041565
Gene NameL3MBTL4 histone methyl-lysine binding protein
Synonyms
MMRRC Submission 038787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0598 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location68273797-68777961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 68459773 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 158 (D158E)
Ref Sequence ENSEMBL: ENSMUSP00000094892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093007] [ENSMUST00000124543] [ENSMUST00000139383]
Predicted Effect probably benign
Transcript: ENSMUST00000093007
AA Change: D158E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094892
Gene: ENSMUSG00000041565
AA Change: D158E

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 378 407 8.1e-16 PFAM
SAM 540 607 5.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124543
AA Change: D158E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121045
Gene: ENSMUSG00000041565
AA Change: D158E

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 376 407 3.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139383
AA Change: D158E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117626
Gene: ENSMUSG00000041565
AA Change: D158E

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150573
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,404 S196L probably benign Het
3110035E14Rik T G 1: 9,619,842 I98S probably benign Het
4933427I04Rik A T 4: 123,860,888 E198D possibly damaging Het
Abca6 A T 11: 110,197,154 I1049N probably damaging Het
Acly A T 11: 100,478,390 N1014K probably damaging Het
Aph1c A T 9: 66,833,319 W42R probably damaging Het
Bptf G T 11: 107,072,965 T1738K probably damaging Het
Cdhr2 A T 13: 54,726,739 I875F probably damaging Het
Cpt2 G T 4: 107,906,938 T543N probably damaging Het
Dnah9 T C 11: 66,118,877 E728G probably benign Het
Doxl2 A G 6: 48,975,537 E132G probably benign Het
Gm5689 T A 18: 42,173,371 M1K probably null Het
Itgbl1 A G 14: 123,857,436 H167R possibly damaging Het
Kctd1 A G 18: 15,007,765 V40A probably damaging Het
Lrp8 A C 4: 107,857,237 I603L possibly damaging Het
Mrps9 C T 1: 42,905,417 T365I probably damaging Het
Olfr1389 A G 11: 49,431,403 D309G probably benign Het
Olfr20 G T 11: 73,353,903 R50L probably benign Het
Olfr403 A T 11: 74,195,832 T110S possibly damaging Het
Padi1 C A 4: 140,814,787 R608L possibly damaging Het
Pkhd1 A T 1: 20,200,890 F3146L probably damaging Het
Rnf145 T C 11: 44,548,943 S189P probably damaging Het
Sez6 G T 11: 77,977,821 D974Y possibly damaging Het
St3gal3 A T 4: 118,107,632 L11Q probably benign Het
Syt14 T C 1: 192,897,314 E554G probably damaging Het
Tectb G T 19: 55,189,586 E170* probably null Het
Themis2 A T 4: 132,789,683 C169S possibly damaging Het
Tmem88b A T 4: 155,784,367 D141E probably benign Het
Uaca T A 9: 60,870,921 Y685* probably null Het
Vsnl1 T C 12: 11,386,859 S40G probably benign Het
Wdr64 A T 1: 175,805,899 Q905H probably damaging Het
Other mutations in L3mbtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:L3mbtl4 APN 17 68630202 missense probably damaging 1.00
IGL02274:L3mbtl4 APN 17 68764584 missense probably benign 0.01
IGL02304:L3mbtl4 APN 17 68587185 nonsense probably null
IGL02473:L3mbtl4 APN 17 68559777 missense possibly damaging 0.93
IGL02543:L3mbtl4 APN 17 68461612 splice site probably benign
IGL02706:L3mbtl4 APN 17 68486919 missense probably damaging 1.00
IGL02729:L3mbtl4 APN 17 68484743 missense probably benign 0.23
IGL02817:L3mbtl4 APN 17 68630254 missense probably benign 0.30
IGL03237:L3mbtl4 APN 17 68777861 missense probably damaging 1.00
IGL03371:L3mbtl4 APN 17 68461568 missense probably damaging 1.00
R0092:L3mbtl4 UTSW 17 68425703 missense probably benign 0.01
R0389:L3mbtl4 UTSW 17 68455780 missense probably damaging 1.00
R0504:L3mbtl4 UTSW 17 68777912 missense probably benign 0.07
R0650:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0652:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0842:L3mbtl4 UTSW 17 68486962 missense probably benign 0.19
R1900:L3mbtl4 UTSW 17 68459805 missense probably damaging 0.99
R2065:L3mbtl4 UTSW 17 68425692 missense probably benign 0.04
R2173:L3mbtl4 UTSW 17 68587193 missense probably damaging 1.00
R2987:L3mbtl4 UTSW 17 68359518 missense possibly damaging 0.89
R3119:L3mbtl4 UTSW 17 68425674 missense probably benign 0.02
R3153:L3mbtl4 UTSW 17 68457248 nonsense probably null
R4044:L3mbtl4 UTSW 17 68777914 missense possibly damaging 0.63
R4579:L3mbtl4 UTSW 17 68764640 missense probably benign
R4717:L3mbtl4 UTSW 17 68455713 missense probably null 0.67
R4798:L3mbtl4 UTSW 17 68359480 start codon destroyed probably null 0.03
R4831:L3mbtl4 UTSW 17 68461563 missense probably damaging 0.98
R4852:L3mbtl4 UTSW 17 68559753 missense probably damaging 1.00
R5226:L3mbtl4 UTSW 17 68764722 critical splice donor site probably null
R5402:L3mbtl4 UTSW 17 68455774 missense probably damaging 1.00
R5604:L3mbtl4 UTSW 17 68777922 missense probably benign 0.01
R6377:L3mbtl4 UTSW 17 68777923 missense probably benign 0.04
R6708:L3mbtl4 UTSW 17 68630258 missense probably benign 0.19
R6853:L3mbtl4 UTSW 17 68777920 missense probably damaging 0.97
R6905:L3mbtl4 UTSW 17 68777888 missense probably benign 0.05
R7018:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
R7045:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7047:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7049:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7419:L3mbtl4 UTSW 17 68641542 missense probably benign 0.28
R8271:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
X0063:L3mbtl4 UTSW 17 68630253 missense probably benign 0.37
Z1176:L3mbtl4 UTSW 17 68425687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGCAACCACTTGGGGACTC -3'
(R):5'- CACTTGCTGCAAGCAAAAGGGG -3'

Sequencing Primer
(F):5'- CATCTGTGAAGAGTGACATACTGTG -3'
(R):5'- acaaaaaacaaaaaaGCTATTTGCTC -3'
Posted On2013-07-11