Incidental Mutation 'R7117:Cers2'
ID 551824
Institutional Source Beutler Lab
Gene Symbol Cers2
Ensembl Gene ENSMUSG00000015714
Gene Name ceramide synthase 2
Synonyms Trh3, 0610013I17Rik, Lass2, CerS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock # R7117 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 95314791-95323599 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 95320761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171] [ENSMUST00000129267] [ENSMUST00000139498] [ENSMUST00000139866]
AlphaFold Q924Z4
Predicted Effect probably benign
Transcript: ENSMUST00000015841
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000015858
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000015858
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107170
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107171
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129267
SMART Domains Protein: ENSMUSP00000121110
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
transmembrane domain 136 155 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139498
SMART Domains Protein: ENSMUSP00000122672
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
Pfam:Homeobox 65 127 5.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000139866
SMART Domains Protein: ENSMUSP00000120190
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 246 4.28e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has sequence similarity to yeast longevity assurance gene 1. Mutation or overexpression of the related gene in yeast has been shown to alter yeast lifespan. The human protein may play a role in the regulation of cell growth. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal ceramide species and myelin sheath defects and develop hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Cers2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Cers2 APN 3 95321900 missense probably damaging 1.00
IGL00328:Cers2 APN 3 95320686 missense probably benign 0.37
IGL01561:Cers2 APN 3 95322161 splice site probably null
IGL02993:Cers2 APN 3 95320085 missense probably benign 0.00
IGL03115:Cers2 APN 3 95321352 missense probably damaging 1.00
IGL03232:Cers2 APN 3 95320157 missense probably damaging 0.97
R0118:Cers2 UTSW 3 95320226 missense probably benign 0.00
R2849:Cers2 UTSW 3 95322459 missense probably benign 0.42
R4709:Cers2 UTSW 3 95320223 missense possibly damaging 0.82
R5320:Cers2 UTSW 3 95320994 missense probably null 0.99
R5662:Cers2 UTSW 3 95320984 missense probably damaging 1.00
R5821:Cers2 UTSW 3 95321697 intron probably benign
R6808:Cers2 UTSW 3 95321009 missense probably benign 0.27
R7049:Cers2 UTSW 3 95321654 missense probably damaging 1.00
R7388:Cers2 UTSW 3 95321345 missense probably benign 0.14
R8059:Cers2 UTSW 3 95322671 missense probably damaging 1.00
R9783:Cers2 UTSW 3 95322127 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCCCAGAATTAAGTCTTGCAG -3'
(R):5'- ACCTCCACCTAGGCATAGTAAG -3'

Sequencing Primer
(F):5'- CCAGAATTAAGTCTTGCAGTACTTTC -3'
(R):5'- GACCAGTATATTCAGCCTTCAGATC -3'
Posted On 2019-05-15