Incidental Mutation 'R7117:Unc13b'
ID551830
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43216544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 281 (I281T)
Ref Sequence ENSEMBL: ENSMUSP00000146589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168032
SMART Domains Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C1 147 196 4.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207569
Predicted Effect probably benign
Transcript: ENSMUST00000207708
AA Change: I281T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAGGAACTCCATGTAGAAAG -3'
(R):5'- GCCGAAGAGCTGGTTTATCC -3'

Sequencing Primer
(F):5'- CCAGAGAGGAAGCCATTCTTTATC -3'
(R):5'- CCTGATTTAAAGAGTTCCAACTGTG -3'
Posted On2019-05-15