Incidental Mutation 'R7117:Usp1'
ID551832
Institutional Source Beutler Lab
Gene Symbol Usp1
Ensembl Gene ENSMUSG00000028560
Gene Nameubiquitin specific peptidase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98923810-98935543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98928890 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 106 (K106N)
Ref Sequence ENSEMBL: ENSMUSP00000030289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030289] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000169053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030289
AA Change: K106N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: K106N

DomainStartEndE-ValueType
Pfam:UCH 80 616 9.2e-35 PFAM
Pfam:UCH_1 415 618 1.3e-11 PFAM
Pfam:UCH 723 781 3.9e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000091358
AA Change: K106N

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: K106N

DomainStartEndE-ValueType
Pfam:UCH 80 622 5e-39 PFAM
Pfam:UCH_1 346 613 2.8e-11 PFAM
low complexity region 765 779 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000125104
AA Change: K63N

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560
AA Change: K63N

DomainStartEndE-ValueType
Pfam:UCH 37 150 4.1e-14 PFAM
Pfam:UCH_1 38 80 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169053
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Usp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Usp1 APN 4 98934581 splice site probably null
IGL02692:Usp1 APN 4 98928960 missense probably benign 0.00
R1782:Usp1 UTSW 4 98934198 missense probably damaging 1.00
R1991:Usp1 UTSW 4 98934294 missense probably benign 0.00
R1992:Usp1 UTSW 4 98934294 missense probably benign 0.00
R2273:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2274:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2275:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R3750:Usp1 UTSW 4 98934120 splice site probably null
R3886:Usp1 UTSW 4 98929736 missense probably damaging 1.00
R4014:Usp1 UTSW 4 98934702 missense probably damaging 1.00
R5141:Usp1 UTSW 4 98934209 missense probably damaging 1.00
R5304:Usp1 UTSW 4 98934618 missense probably benign
R5388:Usp1 UTSW 4 98931057 missense probably benign
R5709:Usp1 UTSW 4 98931123 missense probably damaging 0.99
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6592:Usp1 UTSW 4 98926519 missense possibly damaging 0.86
R6956:Usp1 UTSW 4 98931006 missense probably damaging 0.96
R7396:Usp1 UTSW 4 98926451 intron probably benign
R7516:Usp1 UTSW 4 98934119 missense probably damaging 1.00
R7590:Usp1 UTSW 4 98934252 missense possibly damaging 0.67
R7828:Usp1 UTSW 4 98932307 missense probably damaging 1.00
R8050:Usp1 UTSW 4 98928913 missense probably benign 0.10
R8085:Usp1 UTSW 4 98928341 missense probably damaging 1.00
R8298:Usp1 UTSW 4 98930899 missense probably damaging 1.00
R8736:Usp1 UTSW 4 98932868 missense probably damaging 1.00
R8801:Usp1 UTSW 4 98934611 missense probably benign
R8844:Usp1 UTSW 4 98934780 missense probably damaging 1.00
R8887:Usp1 UTSW 4 98930948 missense probably benign 0.43
R8899:Usp1 UTSW 4 98931110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAAGTGCTGCTGAGGATC -3'
(R):5'- TGTTCTGAACTCTCCTGAGAATC -3'

Sequencing Primer
(F):5'- CTGAGGATCAGTGGTTACTCTTG -3'
(R):5'- ATGTGTAGCCCATCTAGCCAG -3'
Posted On2019-05-15