Incidental Mutation 'R7117:Kit'
ID551837
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75607098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 47 (I47K)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: I47K

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: I47K

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: I47K

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: I47K

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
Mooyah2 UTSW 5 75652808 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7379:Kit UTSW 5 75647752 missense probably damaging 1.00
R7427:Kit UTSW 5 75645847 missense possibly damaging 0.92
R7438:Kit UTSW 5 75639000 missense probably benign 0.01
R7531:Kit UTSW 5 75607040 missense probably damaging 0.99
R7711:Kit UTSW 5 75637359 missense probably damaging 0.97
R7810:Kit UTSW 5 75609322 missense probably benign 0.11
R7819:Kit UTSW 5 75645932 missense probably benign 0.41
R8021:Kit UTSW 5 75615491 missense possibly damaging 0.79
R8139:Kit UTSW 5 75652805 missense probably damaging 0.99
R8165:Kit UTSW 5 75620880 missense possibly damaging 0.94
R8249:Kit UTSW 5 75641408 missense probably damaging 0.97
R8288:Kit UTSW 5 75654489 missense probably damaging 1.00
R8290:Kit UTSW 5 75641169 missense probably benign
R8829:Kit UTSW 5 75639131 missense probably benign 0.41
R8832:Kit UTSW 5 75639131 missense probably benign 0.41
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACAGAATTCCCTTTGCAGCC -3'
(R):5'- AATAGAACTCGTGAGGCCATTG -3'

Sequencing Primer
(F):5'- CTTTGCAGCCACAAATAGCAGGG -3'
(R):5'- CATTGCTGTTGCTGCACG -3'
Posted On2019-05-15