Incidental Mutation 'R7117:Muc5ac'
ID 551851
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission 045208-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7117 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141342709-141372968 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 141367559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 2993 (Y2993*)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000041924
AA Change: Y2289*
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: Y2289*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155534
AA Change: Y2993*
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: Y2993*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163321
AA Change: Y2289*
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: Y2289*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,339,250 (GRCm39) Y254C probably benign Het
4930480E11Rik G T X: 77,414,311 (GRCm39) M345I probably benign Het
Adam12 T C 7: 133,518,191 (GRCm39) I650V probably benign Het
Adam39 G T 8: 41,279,279 (GRCm39) G557C probably damaging Het
Ak5 A G 3: 152,321,493 (GRCm39) probably null Het
Arhgef10l C T 4: 140,291,497 (GRCm39) probably null Het
Arhgef37 C T 18: 61,637,481 (GRCm39) E394K probably benign Het
Baz2b A G 2: 59,742,841 (GRCm39) V13A Het
Bnc1 G T 7: 81,623,109 (GRCm39) A706E possibly damaging Het
Bscl2 G A 19: 8,825,878 (GRCm39) A421T possibly damaging Het
Btn1a1 A C 13: 23,643,415 (GRCm39) W345G possibly damaging Het
C3 A T 17: 57,519,655 (GRCm39) M1199K probably benign Het
Ccdc18 T G 5: 108,296,835 (GRCm39) L213V possibly damaging Het
Cers2 T C 3: 95,228,072 (GRCm39) probably null Het
Chpt1 T A 10: 88,316,711 (GRCm39) H249L probably damaging Het
Cited2 A G 10: 17,600,364 (GRCm39) E224G possibly damaging Het
Cntn5 T A 9: 10,904,704 (GRCm39) probably benign Het
Col28a1 A G 6: 8,013,122 (GRCm39) S977P possibly damaging Het
Col6a1 T C 10: 76,560,843 (GRCm39) K52E probably damaging Het
Cpne2 T A 8: 95,282,172 (GRCm39) H239Q probably damaging Het
Cr2 A T 1: 194,842,909 (GRCm39) N244K possibly damaging Het
Csf2rb2 T C 15: 78,169,385 (GRCm39) D590G probably damaging Het
Defb25 A C 2: 152,464,380 (GRCm39) C55G probably damaging Het
Dnah7b A T 1: 46,391,973 (GRCm39) probably null Het
Dvl3 T A 16: 20,346,072 (GRCm39) Y467* probably null Het
Elapor2 T A 5: 9,495,384 (GRCm39) C729* probably null Het
Extl2 T C 3: 115,821,088 (GRCm39) S312P probably damaging Het
Fam178b T C 1: 36,639,548 (GRCm39) T313A probably benign Het
Fam186b A G 15: 99,183,471 (GRCm39) Y58H probably damaging Het
Fat1 A T 8: 45,484,505 (GRCm39) I3248L probably damaging Het
Fat2 A G 11: 55,172,088 (GRCm39) F2875S probably damaging Het
Flnb T A 14: 7,894,214 (GRCm38) N760K probably benign Het
Galnt14 T C 17: 73,801,190 (GRCm39) H544R probably benign Het
Gpr137c A C 14: 45,516,484 (GRCm39) R357S probably damaging Het
Grk2 A G 19: 4,340,630 (GRCm39) probably null Het
Hectd2 A T 19: 36,577,055 (GRCm39) T342S probably benign Het
Hjv G T 3: 96,435,542 (GRCm39) V267L possibly damaging Het
Ildr2 G T 1: 166,123,380 (GRCm39) G270C probably damaging Het
Insm2 C A 12: 55,647,357 (GRCm39) A367D probably damaging Het
Kcnh5 T A 12: 75,161,219 (GRCm39) I230F possibly damaging Het
Keg1 T A 19: 12,687,042 (GRCm39) S24T probably damaging Het
Kera A T 10: 97,448,714 (GRCm39) E311D probably benign Het
Kit T A 5: 75,767,758 (GRCm39) I47K probably benign Het
Megf6 A G 4: 154,343,379 (GRCm39) T663A possibly damaging Het
Mettl21c G A 1: 44,049,808 (GRCm39) A79V probably damaging Het
Mfsd1 T A 3: 67,507,391 (GRCm39) probably null Het
Mob3b A G 4: 34,985,914 (GRCm39) probably null Het
Morc2b T A 17: 33,356,926 (GRCm39) H282L probably benign Het
Mtpap T C 18: 4,380,889 (GRCm39) probably null Het
Mtus1 A G 8: 41,536,621 (GRCm39) V365A possibly damaging Het
Mycbp2 A C 14: 103,391,513 (GRCm39) F3422V probably benign Het
Ndufb7 T A 8: 84,297,490 (GRCm39) D48E probably benign Het
Nxpe5 A G 5: 138,237,704 (GRCm39) Y88C probably damaging Het
Or51a6 T A 7: 102,604,185 (GRCm39) M208L probably benign Het
Or5d3 A G 2: 88,174,905 (GRCm39) L64P probably damaging Het
Osbpl5 T A 7: 143,263,520 (GRCm39) D121V probably benign Het
Oxnad1 A T 14: 31,813,608 (GRCm39) H3L probably benign Het
Pam C A 1: 97,904,841 (GRCm39) probably benign Het
Papolg T C 11: 23,845,207 (GRCm39) probably benign Het
Pax1 G A 2: 147,208,190 (GRCm39) G266D probably damaging Het
Pde11a A T 2: 75,906,348 (GRCm39) M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Phf21a A T 2: 92,189,502 (GRCm39) Q587L probably benign Het
Plcb3 A G 19: 6,941,746 (GRCm39) L336P probably damaging Het
Pnp2 T C 14: 51,201,931 (GRCm39) *306Q probably null Het
Pou5f2 A G 13: 78,173,392 (GRCm39) I111M probably benign Het
Pramel32 T A 4: 88,547,195 (GRCm39) M246L probably damaging Het
Prmt3 G T 7: 49,467,843 (GRCm39) A350S probably benign Het
Rac3 A T 11: 120,614,343 (GRCm39) R163* probably null Het
Raly G T 2: 154,699,432 (GRCm39) V79L probably benign Het
Rbm20 A T 19: 53,839,989 (GRCm39) T993S possibly damaging Het
Rwdd3 A G 3: 120,964,987 (GRCm39) L56P probably benign Het
Serpina3a C T 12: 104,082,436 (GRCm39) H70Y possibly damaging Het
Sez6l2 A C 7: 126,552,915 (GRCm39) E227A possibly damaging Het
Shank1 C T 7: 43,976,585 (GRCm39) A561V unknown Het
Sidt2 C T 9: 45,864,517 (GRCm39) V71I probably benign Het
Slc35f6 T C 5: 30,815,051 (GRCm39) L326P probably damaging Het
Sox2 G A 3: 34,705,075 (GRCm39) G171S possibly damaging Het
Spef2 G A 15: 9,729,924 (GRCm39) R65C probably damaging Het
Spmap2 A T 10: 79,420,741 (GRCm39) probably null Het
Stip1 C T 19: 6,999,178 (GRCm39) G467S possibly damaging Het
Tada2a T A 11: 83,976,514 (GRCm39) I327F probably damaging Het
Tex2 A G 11: 106,435,071 (GRCm39) V785A unknown Het
Thada C A 17: 84,538,214 (GRCm39) probably null Het
Tmed1 G A 9: 21,420,550 (GRCm39) T94M possibly damaging Het
Tsr1 G T 11: 74,790,360 (GRCm39) M149I probably benign Het
Ttc8 T C 12: 98,942,761 (GRCm39) Y434H possibly damaging Het
Ttn A G 2: 76,578,519 (GRCm39) Y24125H probably damaging Het
Ttn G T 2: 76,552,253 (GRCm39) probably null Het
Ttn A G 2: 76,773,235 (GRCm39) I2435T unknown Het
Uggt2 T C 14: 119,251,938 (GRCm39) I1174M probably benign Het
Unc13b T C 4: 43,216,544 (GRCm39) I281T probably benign Het
Usp1 G T 4: 98,817,127 (GRCm39) K106N possibly damaging Het
Vwa3b A G 1: 37,174,634 (GRCm39) D15G Het
Zfp28 G A 7: 6,397,461 (GRCm39) C632Y probably damaging Het
Zfp68 T C 5: 138,604,580 (GRCm39) D581G probably benign Het
Zmynd10 A C 9: 107,424,716 (GRCm39) S21R probably benign Het
Zswim4 C T 8: 84,940,681 (GRCm39) R806H probably damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141,366,440 (GRCm39) missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141,361,210 (GRCm39) missense probably benign 0.12
IGL01155:Muc5ac APN 7 141,360,680 (GRCm39) splice site probably benign
IGL01452:Muc5ac APN 7 141,371,292 (GRCm39) missense probably benign 0.00
IGL01590:Muc5ac APN 7 141,352,630 (GRCm39) missense probably benign 0.02
IGL02104:Muc5ac APN 7 141,364,815 (GRCm39) missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141,353,914 (GRCm39) missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141,372,537 (GRCm39) nonsense probably null
IGL02178:Muc5ac APN 7 141,359,184 (GRCm39) splice site probably benign
IGL02403:Muc5ac APN 7 141,357,187 (GRCm39) missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141,370,781 (GRCm39) missense probably benign 0.01
IGL02665:Muc5ac APN 7 141,344,823 (GRCm39) missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141,349,000 (GRCm39) missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141,359,512 (GRCm39) missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141,367,518 (GRCm39) missense probably benign 0.34
IGL03384:Muc5ac APN 7 141,366,140 (GRCm39) missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141,348,950 (GRCm39) missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141,361,153 (GRCm39) missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141,372,367 (GRCm39) missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141,349,012 (GRCm39) missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141,364,776 (GRCm39) missense probably benign 0.08
R0363:Muc5ac UTSW 7 141,354,697 (GRCm39) missense probably benign 0.01
R0384:Muc5ac UTSW 7 141,365,988 (GRCm39) missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141,345,771 (GRCm39) nonsense probably null
R0583:Muc5ac UTSW 7 141,361,345 (GRCm39) missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141,349,981 (GRCm39) missense probably benign 0.02
R0682:Muc5ac UTSW 7 141,359,406 (GRCm39) missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141,361,446 (GRCm39) missense probably benign 0.03
R0883:Muc5ac UTSW 7 141,350,002 (GRCm39) missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141,361,252 (GRCm39) missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141,370,666 (GRCm39) missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141,361,060 (GRCm39) missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141,361,114 (GRCm39) missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141,367,629 (GRCm39) splice site probably null
R1599:Muc5ac UTSW 7 141,352,640 (GRCm39) missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141,355,268 (GRCm39) missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141,360,823 (GRCm39) missense probably benign 0.00
R1911:Muc5ac UTSW 7 141,350,041 (GRCm39) missense probably benign 0.18
R1922:Muc5ac UTSW 7 141,347,426 (GRCm39) missense probably benign 0.03
R1966:Muc5ac UTSW 7 141,357,113 (GRCm39) missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141,366,889 (GRCm39) missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141,345,772 (GRCm39) missense probably benign 0.01
R2126:Muc5ac UTSW 7 141,364,479 (GRCm39) missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141,366,084 (GRCm39) missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2259:Muc5ac UTSW 7 141,344,745 (GRCm39) missense probably benign 0.41
R2293:Muc5ac UTSW 7 141,360,936 (GRCm39) missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141,371,841 (GRCm39) missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141,344,877 (GRCm39) missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141,361,378 (GRCm39) missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141,346,473 (GRCm39) splice site probably null
R3762:Muc5ac UTSW 7 141,361,212 (GRCm39) missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141,352,238 (GRCm39) missense probably benign 0.32
R3806:Muc5ac UTSW 7 141,367,471 (GRCm39) missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141,368,460 (GRCm39) missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141,344,961 (GRCm39) missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141,356,629 (GRCm39) missense probably benign
R3981:Muc5ac UTSW 7 141,367,512 (GRCm39) missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141,353,581 (GRCm39) critical splice donor site probably null
R4043:Muc5ac UTSW 7 141,361,215 (GRCm39) missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141,364,867 (GRCm39) missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141,356,572 (GRCm39) missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141,370,847 (GRCm39) missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141,344,840 (GRCm39) missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141,343,500 (GRCm39) missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141,371,338 (GRCm39) missense probably benign 0.00
R4789:Muc5ac UTSW 7 141,352,619 (GRCm39) missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141,371,639 (GRCm39) nonsense probably null
R4971:Muc5ac UTSW 7 141,370,015 (GRCm39) missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141,363,193 (GRCm39) intron probably benign
R5088:Muc5ac UTSW 7 141,350,056 (GRCm39) missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141,368,479 (GRCm39) missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141,347,708 (GRCm39) missense probably benign 0.32
R5366:Muc5ac UTSW 7 141,361,287 (GRCm39) missense probably benign 0.01
R5497:Muc5ac UTSW 7 141,361,380 (GRCm39) missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141,361,569 (GRCm39) missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141,347,452 (GRCm39) critical splice donor site probably null
R5811:Muc5ac UTSW 7 141,352,721 (GRCm39) missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141,371,644 (GRCm39) missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141,344,406 (GRCm39) nonsense probably null
R5977:Muc5ac UTSW 7 141,350,104 (GRCm39) missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141,365,594 (GRCm39) missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141,354,969 (GRCm39) missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141,369,323 (GRCm39) missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141,343,532 (GRCm39) missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141,370,601 (GRCm39) nonsense probably null
R6341:Muc5ac UTSW 7 141,355,229 (GRCm39) missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141,366,416 (GRCm39) missense probably benign 0.05
R6481:Muc5ac UTSW 7 141,362,808 (GRCm39) intron probably benign
R6483:Muc5ac UTSW 7 141,356,591 (GRCm39) missense probably benign 0.18
R6627:Muc5ac UTSW 7 141,362,427 (GRCm39) intron probably benign
R6636:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141,372,342 (GRCm39) missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141,357,065 (GRCm39) missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141,352,729 (GRCm39) missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141,363,289 (GRCm39) intron probably benign
R6844:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6847:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6852:Muc5ac UTSW 7 141,370,644 (GRCm39) missense probably benign 0.03
R6862:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6863:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6864:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6865:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6874:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6875:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6876:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6877:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6889:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R6920:Muc5ac UTSW 7 141,347,035 (GRCm39) missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141,372,451 (GRCm39) missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7091:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7092:Muc5ac UTSW 7 141,363,385 (GRCm39) intron probably benign
R7110:Muc5ac UTSW 7 141,353,559 (GRCm39) missense possibly damaging 0.95
R7238:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7238:Muc5ac UTSW 7 141,363,254 (GRCm39) missense unknown
R7396:Muc5ac UTSW 7 141,362,152 (GRCm39) missense unknown
R7456:Muc5ac UTSW 7 141,346,904 (GRCm39) missense probably benign 0.32
R7477:Muc5ac UTSW 7 141,370,019 (GRCm39) missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141,367,536 (GRCm39) missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141,362,405 (GRCm39) missense unknown
R7604:Muc5ac UTSW 7 141,363,446 (GRCm39) missense unknown
R7635:Muc5ac UTSW 7 141,359,413 (GRCm39) missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141,359,490 (GRCm39) missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141,363,159 (GRCm39) missense unknown
R7651:Muc5ac UTSW 7 141,349,991 (GRCm39) missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141,363,120 (GRCm39) missense unknown
R7720:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7749:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7750:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7751:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7754:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7798:Muc5ac UTSW 7 141,347,778 (GRCm39) critical splice donor site probably null
R7835:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7837:Muc5ac UTSW 7 141,369,700 (GRCm39) missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141,357,166 (GRCm39) missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141,349,589 (GRCm39) missense probably benign 0.00
R7874:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7876:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7877:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7881:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7884:Muc5ac UTSW 7 141,363,040 (GRCm39) missense unknown
R7921:Muc5ac UTSW 7 141,363,424 (GRCm39) intron probably benign
R7976:Muc5ac UTSW 7 141,363,528 (GRCm39) missense unknown
R8104:Muc5ac UTSW 7 141,358,520 (GRCm39) missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141,361,068 (GRCm39) missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141,356,685 (GRCm39) missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141,363,000 (GRCm39) missense unknown
R8386:Muc5ac UTSW 7 141,361,371 (GRCm39) missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141,364,213 (GRCm39) missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141,360,892 (GRCm39) missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141,370,663 (GRCm39) missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8727:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
R8754:Muc5ac UTSW 7 141,354,008 (GRCm39) missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141,372,609 (GRCm39) missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141,343,493 (GRCm39) missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141,347,091 (GRCm39) missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141,362,712 (GRCm39) missense unknown
R9124:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9131:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9132:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9135:Muc5ac UTSW 7 141,352,218 (GRCm39) missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9157:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9159:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9160:Muc5ac UTSW 7 141,363,529 (GRCm39) missense unknown
R9161:Muc5ac UTSW 7 141,353,026 (GRCm39) missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141,366,093 (GRCm39) missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141,352,637 (GRCm39) missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141,361,098 (GRCm39) missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141,370,800 (GRCm39) nonsense probably null
R9239:Muc5ac UTSW 7 141,353,954 (GRCm39) missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141,364,215 (GRCm39) missense probably benign 0.11
R9287:Muc5ac UTSW 7 141,361,626 (GRCm39) missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141,369,255 (GRCm39) missense probably benign 0.01
R9327:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141,362,559 (GRCm39) missense unknown
R9430:Muc5ac UTSW 7 141,362,569 (GRCm39) missense unknown
R9454:Muc5ac UTSW 7 141,362,431 (GRCm39) missense unknown
R9483:Muc5ac UTSW 7 141,365,465 (GRCm39) nonsense probably null
R9581:Muc5ac UTSW 7 141,363,799 (GRCm39) missense unknown
R9610:Muc5ac UTSW 7 141,350,078 (GRCm39) missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141,349,601 (GRCm39) missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141,364,798 (GRCm39) missense probably benign 0.41
R9760:Muc5ac UTSW 7 141,360,985 (GRCm39) missense probably benign 0.05
R9778:Muc5ac UTSW 7 141,349,021 (GRCm39) nonsense probably null
X0060:Muc5ac UTSW 7 141,357,070 (GRCm39) missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141,365,429 (GRCm39) missense possibly damaging 0.86
Z1088:Muc5ac UTSW 7 141,363,481 (GRCm39) intron probably benign
Z1177:Muc5ac UTSW 7 141,371,777 (GRCm39) missense probably benign 0.33
Z1177:Muc5ac UTSW 7 141,362,961 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGATATCACAGATCTGGAAGCTG -3'
(R):5'- ACTTGGAGTCTTTCCTTCCAGG -3'

Sequencing Primer
(F):5'- CCTCTGGGTGGCAAGTTAAC -3'
(R):5'- CAGGGAAGACTGGTCCTGAGTC -3'
Posted On 2019-05-15