Incidental Mutation 'R7117:Ndufb7'
ID551856
Institutional Source Beutler Lab
Gene Symbol Ndufb7
Ensembl Gene ENSMUSG00000033938
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83566671-83571626 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83570861 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 48 (D48E)
Ref Sequence ENSEMBL: ENSMUSP00000037341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019382] [ENSMUST00000036996] [ENSMUST00000163837] [ENSMUST00000165740] [ENSMUST00000212005] [ENSMUST00000212630] [ENSMUST00000212703] [ENSMUST00000212990]
Predicted Effect probably benign
Transcript: ENSMUST00000019382
SMART Domains Protein: ENSMUSP00000019382
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 81 2e-49 PDB
Blast:UBQ 5 81 8e-13 BLAST
transmembrane domain 85 107 N/A INTRINSIC
Pfam:Steroid_dh 154 308 3.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036996
AA Change: D48E

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037341
Gene: ENSMUSG00000033938
AA Change: D48E

DomainStartEndE-ValueType
Pfam:NDUF_B7 40 102 3.8e-32 PFAM
low complexity region 103 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163837
SMART Domains Protein: ENSMUSP00000128329
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 135 2e-27 PDB
Blast:UBQ 91 135 1e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 362 6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165740
SMART Domains Protein: ENSMUSP00000131389
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 66 1e-31 PDB
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Steroid_dh 139 293 3.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212005
Predicted Effect probably benign
Transcript: ENSMUST00000212630
Predicted Effect probably benign
Transcript: ENSMUST00000212703
Predicted Effect probably benign
Transcript: ENSMUST00000212990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Bscl2 G A 19: 8,848,514 A421T possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Ndufb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2204:Ndufb7 UTSW 8 83570899 missense probably damaging 1.00
R4603:Ndufb7 UTSW 8 83566865 missense probably damaging 0.98
R4620:Ndufb7 UTSW 8 83566858 missense probably damaging 0.99
R4916:Ndufb7 UTSW 8 83570905 missense probably damaging 1.00
R5039:Ndufb7 UTSW 8 83571465 unclassified probably benign
R5120:Ndufb7 UTSW 8 83566977 unclassified probably benign
R5532:Ndufb7 UTSW 8 83571434 missense probably damaging 1.00
R5968:Ndufb7 UTSW 8 83566901 missense probably benign 0.03
R7456:Ndufb7 UTSW 8 83566853 missense probably benign 0.03
R8745:Ndufb7 UTSW 8 83570889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTTAGGACATAGGGGACG -3'
(R):5'- ATGGCTGCAGTGTGGATAGC -3'

Sequencing Primer
(F):5'- GAGGAGTCACCCTTCCTGTCAG -3'
(R):5'- TAGCTGTGGAGAAGGTGGCC -3'
Posted On2019-05-15