Incidental Mutation 'R7117:Bscl2'
ID551897
Institutional Source Beutler Lab
Gene Symbol Bscl2
Ensembl Gene ENSMUSG00000071657
Gene NameBerardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonymsseipin, Gng3lg
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7117 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8837467-8848683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8848514 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 421 (A421T)
Ref Sequence ENSEMBL: ENSMUSP00000127685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086058] [ENSMUST00000096257] [ENSMUST00000159634] [ENSMUST00000159653] [ENSMUST00000160556] [ENSMUST00000160897] [ENSMUST00000171649]
Predicted Effect probably benign
Transcript: ENSMUST00000086058
AA Change: A361T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000083224
Gene: ENSMUSG00000071657
AA Change: A361T

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096257
SMART Domains Protein: ENSMUSP00000093976
Gene: ENSMUSG00000071656

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 83 162 2.81e-5 SMART
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159634
AA Change: A361T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125422
Gene: ENSMUSG00000071657
AA Change: A361T

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159653
SMART Domains Protein: ENSMUSP00000123920
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 1 97 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160556
AA Change: A361T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123976
Gene: ENSMUSG00000071657
AA Change: A361T

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160897
SMART Domains Protein: ENSMUSP00000125250
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 97 208 2.8e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171649
AA Change: A421T

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127685
Gene: ENSMUSG00000071657
AA Change: A421T

DomainStartEndE-ValueType
Pfam:Seipin 99 302 8.5e-66 PFAM
Blast:PAC 329 366 2e-6 BLAST
low complexity region 413 431 N/A INTRINSIC
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe generalized lipodystrophy with hepatic steatosis, glucose intolerance, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,191,384 Y254C probably benign Het
4930480E11Rik G T X: 78,370,705 M345I probably benign Het
9330182L06Rik T A 5: 9,445,384 C729* probably null Het
Adam12 T C 7: 133,916,462 I650V probably benign Het
Adam39 G T 8: 40,826,242 G557C probably damaging Het
Ak5 A G 3: 152,615,856 probably null Het
Arhgef10l C T 4: 140,564,186 probably null Het
Arhgef37 C T 18: 61,504,410 E394K probably benign Het
Baz2b A G 2: 59,912,497 V13A Het
Bnc1 G T 7: 81,973,361 A706E possibly damaging Het
Btn1a1 A C 13: 23,459,245 W345G possibly damaging Het
C3 A T 17: 57,212,655 M1199K probably benign Het
C87499 T A 4: 88,628,958 M246L probably damaging Het
Ccdc18 T G 5: 108,148,969 L213V possibly damaging Het
Cers2 T C 3: 95,320,761 probably null Het
Chpt1 T A 10: 88,480,849 H249L probably damaging Het
Cited2 A G 10: 17,724,616 E224G possibly damaging Het
Cntn5 T A 9: 10,904,699 probably benign Het
Col28a1 A G 6: 8,013,122 S977P possibly damaging Het
Col6a1 T C 10: 76,725,009 K52E probably damaging Het
Cpne2 T A 8: 94,555,544 H239Q probably damaging Het
Cr2 A T 1: 195,160,601 N244K possibly damaging Het
Csf2rb2 T C 15: 78,285,185 D590G probably damaging Het
Defb25 A C 2: 152,622,460 C55G probably damaging Het
Dnah7b A T 1: 46,352,813 probably null Het
Dvl3 T A 16: 20,527,322 Y467* probably null Het
Extl2 T C 3: 116,027,439 S312P probably damaging Het
Fam178b T C 1: 36,600,467 T313A probably benign Het
Fam186b A G 15: 99,285,590 Y58H probably damaging Het
Fat1 A T 8: 45,031,468 I3248L probably damaging Het
Fat2 A G 11: 55,281,262 F2875S probably damaging Het
Flnb T A 14: 7,894,214 N760K probably benign Het
Galnt14 T C 17: 73,494,195 H544R probably benign Het
Gpr137c A C 14: 45,279,027 R357S probably damaging Het
Grk2 A G 19: 4,290,602 probably null Het
Hectd2 A T 19: 36,599,655 T342S probably benign Het
Hfe2 G T 3: 96,528,226 V267L possibly damaging Het
Ildr2 G T 1: 166,295,811 G270C probably damaging Het
Insm2 C A 12: 55,600,572 A367D probably damaging Het
Kcnh5 T A 12: 75,114,445 I230F possibly damaging Het
Keg1 T A 19: 12,709,678 S24T probably damaging Het
Kera A T 10: 97,612,852 E311D probably benign Het
Kit T A 5: 75,607,098 I47K probably benign Het
Megf6 A G 4: 154,258,922 T663A possibly damaging Het
Mettl21c G A 1: 44,010,648 A79V probably damaging Het
Mfsd1 T A 3: 67,600,058 probably null Het
Mob3b A G 4: 34,985,914 probably null Het
Morc2b T A 17: 33,137,952 H282L probably benign Het
Mtpap T C 18: 4,380,889 probably null Het
Mtus1 A G 8: 41,083,584 V365A possibly damaging Het
Muc5ac T A 7: 141,813,822 Y2993* probably null Het
Mycbp2 A C 14: 103,154,077 F3422V probably benign Het
Ndufb7 T A 8: 83,570,861 D48E probably benign Het
Nxpe5 A G 5: 138,239,442 Y88C probably damaging Het
Olfr1177-ps A G 2: 88,344,561 L64P probably damaging Het
Olfr575 T A 7: 102,954,978 M208L probably benign Het
Osbpl5 T A 7: 143,709,783 D121V probably benign Het
Oxnad1 A T 14: 32,091,651 H3L probably benign Het
Pam C A 1: 97,977,116 probably benign Het
Papolg T C 11: 23,895,207 probably benign Het
Pax1 G A 2: 147,366,270 G266D probably damaging Het
Pde11a A T 2: 76,076,004 M623K probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Phf21a A T 2: 92,359,157 Q587L probably benign Het
Plcb3 A G 19: 6,964,378 L336P probably damaging Het
Pnp2 T C 14: 50,964,474 *306Q probably null Het
Pou5f2 A G 13: 78,025,273 I111M probably benign Het
Prmt3 G T 7: 49,818,095 A350S probably benign Het
Rac3 A T 11: 120,723,517 R163* probably null Het
Raly G T 2: 154,857,512 V79L probably benign Het
Rbm20 A T 19: 53,851,558 T993S possibly damaging Het
Rwdd3 A G 3: 121,171,338 L56P probably benign Het
Serpina3a C T 12: 104,116,177 H70Y possibly damaging Het
Sez6l2 A C 7: 126,953,743 E227A possibly damaging Het
Shank1 C T 7: 44,327,161 A561V unknown Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Slc35f6 T C 5: 30,657,707 L326P probably damaging Het
Sox2 G A 3: 34,650,926 G171S possibly damaging Het
Spef2 G A 15: 9,729,838 R65C probably damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tada2a T A 11: 84,085,688 I327F probably damaging Het
Tex2 A G 11: 106,544,245 V785A unknown Het
Thada C A 17: 84,230,786 probably null Het
Theg A T 10: 79,584,907 probably null Het
Tmed1 G A 9: 21,509,254 T94M possibly damaging Het
Tsr1 G T 11: 74,899,534 M149I probably benign Het
Ttc8 T C 12: 98,976,502 Y434H possibly damaging Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Ttn A G 2: 76,942,891 I2435T unknown Het
Ttn G T 2: 76,721,909 probably null Het
Uggt2 T C 14: 119,014,526 I1174M probably benign Het
Unc13b T C 4: 43,216,544 I281T probably benign Het
Usp1 G T 4: 98,928,890 K106N possibly damaging Het
Vwa3b A G 1: 37,135,553 D15G Het
Zfp28 G A 7: 6,394,462 C632Y probably damaging Het
Zfp68 T C 5: 138,606,318 D581G probably benign Het
Zmynd10 A C 9: 107,547,517 S21R probably benign Het
Zswim4 C T 8: 84,214,052 R806H probably damaging Het
Other mutations in Bscl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Bscl2 APN 19 8845276 missense probably damaging 0.99
IGL03206:Bscl2 APN 19 8843089 missense probably damaging 0.97
R0193:Bscl2 UTSW 19 8847429 missense probably benign 0.21
R1112:Bscl2 UTSW 19 8839734 missense possibly damaging 0.90
R1513:Bscl2 UTSW 19 8841145 missense probably damaging 1.00
R2049:Bscl2 UTSW 19 8845320 splice site probably null
R2121:Bscl2 UTSW 19 8839782 nonsense probably null
R2140:Bscl2 UTSW 19 8845320 splice site probably null
R2142:Bscl2 UTSW 19 8845320 splice site probably null
R2483:Bscl2 UTSW 19 8841150 missense probably benign 0.01
R3623:Bscl2 UTSW 19 8841150 missense probably benign 0.01
R4177:Bscl2 UTSW 19 8839756 missense possibly damaging 0.85
R4675:Bscl2 UTSW 19 8848159 missense possibly damaging 0.81
R4967:Bscl2 UTSW 19 8847980 missense probably benign 0.02
R5051:Bscl2 UTSW 19 8845279 nonsense probably null
R5446:Bscl2 UTSW 19 8846200 missense possibly damaging 0.91
R6493:Bscl2 UTSW 19 8839774 missense probably damaging 1.00
R6838:Bscl2 UTSW 19 8841381 missense probably damaging 1.00
R7401:Bscl2 UTSW 19 8846550 missense possibly damaging 0.57
R7923:Bscl2 UTSW 19 8847519 missense probably benign 0.00
R8249:Bscl2 UTSW 19 8846520 missense probably damaging 1.00
R8332:Bscl2 UTSW 19 8846230 missense probably benign 0.23
R8748:Bscl2 UTSW 19 8847947 missense probably damaging 0.99
R8870:Bscl2 UTSW 19 8847429 missense probably benign 0.02
R8926:Bscl2 UTSW 19 8847984 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTGTTTCCCTTTGGCTGAAGAG -3'
(R):5'- GATGTCCACACAAGCAGCTG -3'

Sequencing Primer
(F):5'- TGAAGAGGGCCAGCTGTCTG -3'
(R):5'- GCTGCCACAAAATAGTTTATTAAGGG -3'
Posted On2019-05-15